RESUMO
La sigatoka negra en el cultivo del plátano es considerada como una de las enfermedades más limitante de la producción, a nivel mundial, siendo manejada con fungicidas, ocasionando contaminaciones ambientales e incremento de los costos de producción. Como estrategia no contaminante, algunos investigadores recomiendan cultivar en condiciones de sombrío, para reducir la enfermedad. El objetivo de este trabajo fue evaluar el efecto de diferentes porcentajes de sombrío en la incidencia de la enfermedad y en la producción, bajo condiciones del Caribe húmedo colombiano. En condiciones de campo, se estableció el cultivar 'Hartón', en un diseño de bloques completos al azar y cuatro porcentajes de sombrío, 20, 35 y 50%, teniendo como testigo plantas cultivadas a libre exposición solar 100%. Las evaluaciones, se realizaron durante el periodo de floración del cultivo, cuantificando el número de hojas funcionales NHF, la hoja más joven con síntomas HMJS, la hoja más joven enferma HMJE, el índice de severidad IS y rendimiento. Los tratamientos con 20, 35 y 50% de sombrío no presentaron diferencias estadísticas entre sí; más sí, con el testigo en las variables NHF, HMJE, IS y rendimiento. Los tratamientos con sombra manifestaron menor IS de la sigatoka negra, de 13 al 15%, mientras el testigo fue del 18%; además, los rendimientos se incrementaron en 400kg ha-1. Se concluye, que el cultivo de plátano 'Hartón', manejado a partir del 20% de sombrío, fue suficiente para reducir la severidad de la sigatoka negra e incrementar significativamente los rendimientos.
Black sigatoka in plantain cultivation is considered one of the most limiting production diseases worldwide. It is managed with fungicides, causing environmental pollution and increased production costs. As a nonpolluting strategy, some researchers recommend cultivating shade conditions to reduce the disease. The aim of this study was to evaluate the effect of different shade percentages in the incidence of disease and production under the Caribbean Colombian humid conditions. Under field conditions it was established to cultivate the 'Harton' in a completely randomized block design and four shade percentages 20, 35 and 50%, having as control plants growing in 100% sun exposure. Evaluations were performed during the flowering period of the crop, quantifying the number of functional leaves NFL, the youngest leaf with symptoms YLS, the youngest diseased leaf YDL, the severity index SI and yield. Treatments with 20, 35 and 50% shade were not statistically different from each other; but with the witness in the NFL, YLS, SI and yield. Treatments with shade had lower SI of black sigatoka, between 13 to 15%; while the witness was 18%; also the yield increased in 400kg ha-1. It is concluded that growing 'Harton', managed from 20% shade was enough to reduce the severity of black sigatoka and significantly increase yields.
RESUMO
In August 2010, lesions similar to those reported for target spot were observed on Nicotiana tabacum L. plants produced in float systems in Cerrillos, Salta, Argentina. Tobacco leaves with characteristic lesions were collected from different locations in Cerrillos, Salta. Symptoms ranged from small (2 to 3 mm), water-soaked spots to larger (2 to 3 cm), necrotic lesions that had a pattern of concentric rings, tears in the centers, and margins that often resulted in a shot-hole appearance. Isolation of the causal agent was made on potato dextrose agar (PDA) acidified to pH 5 with 10% lactic acid and incubated at 25 ± 2°C in darkness for 2 to 3 days. Hyphal tips were transferred to a new medium and the cultures were examined for morphological characters microscopically (3). Eight isolates were obtained. The rapid nuclear-staining procedure using acridine orange (3) was used to determine the number of nuclei in hyphal cells. Multinucleate hyphae were observed, with 4 to 9 nuclei per cell. Molecular characterization was conducted by examining the internal transcribed spacer (ITS) region from all of the isolates of the pathogen identified as Rhizoctonia solani based on morphological characteristics (1). Fragments amplified using primers ITS1 (5'TCCGTAGGTGAACCTGCGG3') and ITS4 (5'TCCTCCGCTTATTGATATGC3') (4) were sequenced and compared with R. solani anastomosis group (AG) sequences available in the NCBI GenBank database. Sequence comparison identified this new isolate as R. solani anastomosis group AG 2-1. Previous isolates of target spot were identified as AG 3 (2). The isolates that were studied were deposited in the "Laboratorio de Sanidad Vegetal" INTA-EEA-Salta Microbial Collection as Rs59c, Rs59b, Rs59, Rs66, Rs67, Rs68, Rs69, and Rs70. The ITS nucleotide sequence of isolate Rs59 has been assigned the GenBank Accession No. JF792354. Pathogenicity tests for each isolate were performed using tobacco plants grown for 8 weeks at 25 ± 2°C with a 12-h photoperiod. Ten plants were inoculated by depositing PDA plugs (0.2 cm) colonized with R. solani onto leaves; plants inoculated with the pure PDA plug without pathogen served as controls. The plants were placed in a 25 ± 2°C growth chamber and misted and covered with polyethylene bags that were removed after 2 days when plants were moved to a glasshouse. After 48 h, symptoms began as small (1 to 2 mm), circular, water-soaked spots, lesions enlarged rapidly, and often developed a pattern of concentric rings of 1 to 2 cm. After 8 days, all inoculated plants showed typical disease symptoms. Morphological characteristics of the pathogen reisolated from symptomatic plants were consistent with R. solani. Control plants remained healthy. These results correspond to the first reports of the disease in the country. Compared to other areas in the world, target spot symptoms were only observed in tobacco plants produced in float systems and were not observed in the field. The prevalence of the disease in Salta, Argentina was 7%. To our knowledge, this is the first report of R. solani AG2.1 causing target spot of tobacco. References: (1) M. Sharon et al. Mycoscience 49:93, 2008. (2) H. Shew and T. Melton. Plant Dis. 79:6, 1995. (3) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St. Paul, MN, 1991. (4) T. J. White et al. Page 282 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.
RESUMO
Immunohistochemical staining is useful in the diagnosis of bone marrow infiltration in systemic mastocytosis. However, it is not clear if antibody staining may be helpful in the diagnosis of cutaneous mastocytosis (CM). We studied the histological appearance of CM in 35 pediatric patients. Cases were assigned to three basic clinical groups: I--Urticaria pigmentosa (UP, n=29); II--Mastocytomas (n=4); and III--Diffuse Cutaneous Mastocytosis (DCM, n=2). The analysis of clinical information revealed an association between the presence of diarrhea and a higher number of cells/field. Nine doubtful cases, all of them macules, were selected based on the scarcity of mast cells (MC) and the absence or rarity of other inflammatory cells. We compared the number of cells identified in Giemsa and immunohistochemical stains in definite and doubtful cases. The intraclass correlation statistic tested the concordance between each staining method. All 9 dubious cases according to the Giemsa stain had their CM diagnosis confirmed by the immunohistochemistry analysis. The intraclass correlation between Giemsa and c-kit was good (0.7) when the number of MC was high. However, there was no correlation between the mast cells counts in the two different stains in the dubious cases. The immunohistochemistry with c-kit might make CM diagnosis easier, especially in the macular cases, when there is a lower number of MC.
Assuntos
Mastócitos/patologia , Mastocitoma/patologia , Mastocitose Cutânea/patologia , Proteínas Proto-Oncogênicas c-kit/análise , Pele/patologia , Corantes Azur , Criança , Pré-Escolar , Corantes , Diagnóstico Diferencial , Feminino , Humanos , Imuno-Histoquímica/métodos , Lactente , Masculino , Mastócitos/química , Mastocitoma/química , Mastocitoma/fisiopatologia , Mastocitose Cutânea/química , Mastocitose Cutânea/fisiopatologia , Pele/química , Urticaria Pigmentosa/química , Urticaria Pigmentosa/patologiaRESUMO
Common garden petunias (Petunia × hybrida Hort. Vilm.-Andr.) are herbaceous annual plants with brightly colored flowers up to 10 cm in diameter. During the winter of 2002, crown and root rot were observed on plants (cv. Ultra) growing in five greenhouses in Buenos Aires. Affected plants were randomly distributed in the greenhouses, and mean disease incidence in all the greenhouses was 26%. Basal leaves turned yellow and gradually became necrotic, and infected plants were often killed. Small pieces of affected tissues were disinfested in 2% sodium hypochlorite for 1 min and plated on 2% potato dextrose agar (PDA). Fifteen isolates identified to the genus Rhizoctonia were obtained. Fungal colonies were initially white, turned brown with age, and produced irregularly shaped, brown sclerotia. Hyphal branched at right angles, were constricted at the base of the branch near the union with main hyphae, and septate near the constriction. Basidia were not observed in the greenhouses or on the plates. Isolates were cultivated on water agar and incubated at 25°C for 3 days. Hyphal cells were determined to be multinucleate when stained with 1% aniline blue solution (2) and examined at ×400. Anastomosis group of one isolate was determined by using AG-4 HG II, AG-1 IA, AG-1 IB, AG-1 IC, AG-2 2-1, and AG-2 2IIIB tester strains of Rhizoctonia solani that includes isolates reported to be pathogenic on ornamentals (1). Anastomosis was observed only with strains of AG-4 HG II. Pathogenicity on this isolate was conducted on potted, healthy, adult plants that were 10 to 22 cm high and flowering. Thirty-five plants were inoculated by placing 1 cm2 pieces of PDA from 7-day-old mycelial cultures near the base of the stem. Twelve control plants were treated with 1 cm2 PDA plugs. Plants were kept at 22 to 24°C, >95% relative humidity, and 12 h of fluorescent light. Wilt symptoms due to basal stem rot appeared 7 days after inoculation, and all the inoculated plants died within 27 days. Control plants remained disease free. The pathogen was reisolated from symptomatic tissues, completing Koch's postulates. To our knowledge, this is the first report of R. solani causing disease on petunia in Argentina. References: (1) D. M. Benson and D. K. Cartwright. Ornamental diseases incited by Rhizoctonia spp. Pages 303-314 in: Rhizoctonia species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease Control. B. Sneh et al., eds. Kluwer Academic Publishers, London, England, 1996. (2) C. C. Tu and J. W. Kimbrough. Mycologia 65:941, 1973.
Assuntos
Pré-Escolar , Criança , Adolescente , Humanos , Masculino , Feminino , Pressão Sanguínea , Chile , Fatores Sexuais , Antropometria , Seguimentos , Manometria/métodosRESUMO
[ Introducción] El presente trabajo tuvo por objeto conocer a diferentes MPV la respuesta, en títulos de anticuerpos séricos neutralizantes, inducida por vacuna oleosa contra la FA en grupos de bovinos jóvenes y adultos de tres sitios diferentes de Colombia, con antecedentes de vacunación sistemática aplicada cada cuatro meses con vacuna nacional hidróxido-saponinada.
[Introduction] This study aimed to determine the response at varying MPV"s, in terms of neutralizing antibodies titers induced by FMD oil-adjuvanted vaccine in groups of young and adult cattle. The cattle were observed at three different locations in Colombia, and had a history of systematic vaccination every four months with domestically producced saponin-hydroxide vaccine.