RESUMO

Studies have demonstrated that the prolonged use of corticoids can delay the healing process, affecting re-epithelialization, neovascularization and collagen synthesis. As the fins of teleost fish contain a large amount of collagen, the aim of the present study was to investigate the effect of dexamethasone (anti-inflammatory and glucocorticoid steroid widely used in the treatment of rheumatic diseases) during the regeneration process in the caudal fin of specimens of carp (Cyprinus carpio). For such, two glass aquaria were used - one for a group of fish treated with dexamethasone (Henrifarma) in a 20 mg/L concentration and the other for the control group. The caudal fins were amputated transversally and fish remained in their respective aquaria until regeneration occurred. Samples of regenerating fins were collected on days 1, 2, 4, 6, 8 and 10 after amputation. The fins in the control group regenerated normally and grew within the expected in time course. The fins in the group treated with dexamethasone were significantly smaller in comparison to the control group at every evaluation time. Thus, it was possible to verify that, at this concentration of dexamethasone, the regeneration of the caudal fins was delayed, but not completely inhibited. The results show that the caudal fin is a good model for histological studies on regeneration and the action of drug toxicity, but it's also of great importance the interaction with further studies for a better knowledge and understanding of all the changes in all the phases.

Assuntos

RESUMO

Studies have demonstrated that the prolonged use of corticoids can delay the healing process, affecting re-epithelialization, neovascularization and collagen synthesis. As the fins of teleost fish contain a large amount of collagen, the aim of the present study was to investigate the effect of dexamethasone (anti-inflammatory and glucocorticoid steroid widely used in the treatment of rheumatic diseases) during the regeneration process in the caudal fin of specimens of carp (Cyprinus carpio). For such, two glass aquaria were used one for a group of fish treated with dexamethasone (Henrifarma) in a 20 mg/L concentration and the other for the control group. The caudal fins were amputated transversally and fish remained in their respective aquaria until regeneration occurred. Samples of regenerating fins were collected on days 1, 2, 4, 6, 8 and 10 after amputation. The fins in the control group regenerated normally and grew within the expected in time course. The fins in the group treated with dexamethasone were significantly smaller in comparison to the control group at every evaluation time. Thus, it was possible to verify that, at this concentration of dexamethasone, the regeneration of the caudal fins was delayed, but not completely inhibited. The results show that the caudal fin is a good model for histological studies on regeneration and the action of drug toxicity, but its also of great importance the interaction with further studies for a better knowledge and understanding of all the changes in all the phases.(AU)

Estudos mostram que corticóides usados por longos períodos podem atrasar o processo de cicatrização, influenciando na reepitelização, na neovascularização e na síntese do colágeno. Os constituintes das nadadeiras dos peixes teleósteos contêm grande quantidade de colágeno e assim o objetivo do presente trabalho foi estudar o efeito da dexametasona (um antiinflamatório e glicocorticóide esteróide bastante utilizado no tratamento de doenças reumáticas) durante o processo regenerativo das nadadeiras caudais das carpas (Cyprinus carpio). Para isso, foram montados dois aquários de vidro, um para o grupo controle e outro para o grupo tratado com a dexametasona (Henrifarma) na concentração de 20mg/L. Os peixes distribuídos nesses aquários tiveram suas nadadeiras caudais amputadas transversalmente e permaneceram nos respectivos aquários para que ocorresse a regeneração. Foram feitas coletas das nadadeiras em regeneração em intervalos de 1, 2, 4, 6, 8 e 10 dias após a amputação. Foi observado que nos peixes do grupo controle, as nadadeiras regeneraram normalmente e cresceram o esperado em cada intervalo de tempo. No entanto, foi verificado que nos peixes do grupo tratado com dexametasona, em cada intervalo analisado, as nadadeiras regeneradas dos peixes expostos à droga eram menores que a medida das nadadeiras dos peixes do grupo controle. Assim, foi possível verificar que, nessa concentração de dexametasona, a regeneração das nadadeiras caudais foi mais lenta, mas não ocorreu a total inibição da regeneração. Dessa forma, os resultados comprovam que a nadadeira caudal é um bom modelo para estudos histológicos sobre a regeneração e a ação da toxicidade de drogas, mas, também, é de grande importância a interação com estudos mais aprofundados para se conhecer e compreender melhor todas as alterações em todas as fases.(AU)

Assuntos

RESUMO

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Assuntos

RESUMO

When partially amputated or severely injured, teleost fins suffer a regenerative process called epimorphic regeneration characterised by the following stages: the formation of a multistratified epidermal layer, the disorganisation and distal migration of multipotent mesenchymal cells, the proliferation of these cells in order to form the blastema, continuous proliferation of distal blastema to facilitate the growth, and differentiation of the proximal blastema in order to restore its lost structure. The regeneration of the fin is extremely sensitive to the action of some drugs that can interfere in its structure restoration. For this reason, and also based on papers relating that indomethacin can interfere somehow in the tissue restoration of many different organisms, the aim of this work is to evaluate the possible effects of this drug in three different doses in the regeneration of the teleost fish tail fin, taking into consideration the synthesis, the disposition and organisation of lepidotrichial matrix components, the restoration of actinotrichia, as well as the fin area itself. Therefore, histochemical, ultrastructural and morphometric analysis were done and it was observed that indomethacin in doses of 20 and 30 mg.L-1 caused a delay in the regenerative process of the dermal skeleton (lepidotrichia and actinotrichia) of the tail fins. These doses could have interfered, momentarily, in the process of blastemal cell differentiation in the cells responsible for the synthesis and disposition of actinotrichia and lepidotrichia or, even interfered in the signalling necessary for the recent differentiated cells to begin synthesising the components of the dermal skeleton.

Assuntos

RESUMO

Teleostean fins when partially amputated suffer a regenerative process called epimorphic regeneration, characterized by the following stages: healing, based on the formation of a multistratified epidermal layer, the formation of a mass of pluripotent cells known as blastema, the differentiation of these cells, the synthesis and disposition of the extracellular matrix, morphological growth and restoration. The epidermis has a fundamental role in the regenerative process of fish fins, as the healing time of this structure leads it to a faster regenerative process and it also works as a defense against the external environment. In this sense, due to the fast regeneration shown by the epidermis, the aim of this paper is to study the histology of the regenerative dynamics of the carp fin tail (Cyprinus carpio), under the light and transmission electron microscope. Epidermic regeneration begins right in the first hours after the fin amputation and it continues throughout the regenerative process. After 24 hours, an apical epidermal cap is established. Cytoplasmatic prolongations and intercellular junctions are observed and the cells of the basal layer of the epidermis change from the cubic form to the cylindrical, due to the development of the cytoplasmatic organelles responsible for the synthesis of the basal membrane, lost after amputation. These results show the importance of histological studies in regenerative processes. We believe that the association of molecular biology with histological studies can throw further light onto these regenerative dynamics.

Assuntos

RESUMO

A conglomerate of small, rigid, fusiform spicules known as actinotrichia sustains the edge of tail fins of teleost. After amputation, these structures show an extremely fast regenerative capacity. In this study we observed the effect of a nonsteroidal anti-inflammatory drug, naproxen, used in the treatment of degenerative articular diseases, during the process of actinotrichia regeneration. For this purpose, regenerating tissue from animals in contact with the drug was submitted to histochemical and ultrastructural analysis in comparison to tissue from animals under normal conditions, i.e., not in contact with the drug in question. Actinotrichia regeneration was similar in both animals, indicating that naproxen, at the dose used in the present study, did not interfere with actinotrichia synthesis during the regenerative process of the tail fin. This could be because naproxen did not influence the expression of the genes required for the regeneration process, such as the Sonic hedgehog (Shh) gene, which is involved in actinotrichia formation.

Assuntos

RESUMO

In the present investigation we studied the effect of naproxen, a non-steroidal anti-inflammatory drug used for the treatment of rheumatic disease, on the synthesis of the lepidotrichial matrix of the tail fin of the teleost fish Cyprinus carpio (carp) during the regeneration process. The lepidotrichial synthesis was observed by standard and polarized light microscopy and by transmission electron microscopy. In general, naproxen at the dose used in the present study did not affect the organization of the extracellular matrix components and the mineralization of the fundamental substance of the lepidotrichia during the process of tail fin regeneration. Since the effect of naproxen, as well as of other non-steroidal anti-inflammatory drugs, depends on the dose used, the route of administration and the metabolism of the animal in which the drug is being tested, higher doses of the drug may perhaps delay or even fully inhibit this process, possibly also provoke disorganization of the lepidotrichial matrix.

Assuntos

RESUMO

A light microscopy study of head cartilage tissue in rainbow trout alevins (Oncorhynchus mykiss) infected with the parasite Myxobolus cerebralis showed that, regardless of the presence or absence of whirling disease symptoms such as black tail and whirling swimming due to altered tail and spine morphology, some fish presented large amounts of spores lodged in the head after three months of infection. The spores were located in regions where the cartilage was extensively destroyed.

Assuntos

RESUMO

A light, transmission and scanning microscope study of the rays (lepidotrichia) forming the tail fin of rainbow trout (Oncorhynchus mykiss) fingerlings infected with the parasite Myxobolus cerebralis showed that triactinomyxon adherence to the tail fin of host fingerlings occurred 10 min after infection. After 2 h of exposure, it was possible to observe triactinomyxon spores in the epidermis. Although the characteristic symptoms of the disease, such as a black tail and a change in tail morphology, were observed, there was no attack against the tissue forming the tail fin rays and triactinomyxon spores were not observed inside the leptotrichial matrix at any stage, indicating that the spores do not reach the rays or that their observation was not possible under the conditions of the present study.

Assuntos

RESUMO

Regenerating tail fins were studied in two species of teleosts, Tilapia rendalli and Cyprinus carpio, treated with indomethacin, aspirin, dexamethasone, penicillamine, and beta-aminoproprionitrile, drugs known to disrupt collagen metabolism in mammals. Collagen was studied under the light microscope by the Picrosirius-polarization method and also under the electron microscope. In general, these drugs disturbed the deposition and organization of collagen fibrils leading to abnormally thin or practically absent lepidotrichia and actinotrichia, and also to disorganized fibrous connective tissue. The resulting disorganization of the collagenous scaffolding of the regenerating dermoskeleton was probably responsible for a secondary effect on blastema distalization and on the general fin ray patterning that were also observed. The foregoing observations suggest that the stromal histoarchitecture of the regenerate plays a vital role in fin regeneration and indicate that these drugs may be useful in studying the extracellular matrix-cell interactions at the cellular and molecular level. In addition, the present findings provide a basis for developing different biological models by using teleost fin regeneration.

Assuntos