RESUMO
One of the initial steps in the preprocessing of digital fundoscopy images is the identification of pixels containing relevant information. This can be achieved through different approaches, one of them is implementing background extraction, reducing the set of pixels to be analyzed later in the process. In this work, we present a background extraction method for digital fundoscopy images based on computational topology. By interpreting binarized images as cubical complexes and extracting their homological groups in 1 and 2 dimensions we identify a subset of luminescence values that can be used to binarize the original grayscale image, obtaining a mask to achieve background extraction. This method is robust to noise and suboptimal image quality, facilitating the analytical pipeline in the context of computer aided diagnosis approaches. This method facilitates the segmentation of the background of a digital fundoscopy image, which allows further methods to focus on pixels with relevant information (eye fundus). This tool is best suited to be implemented in the preprocessing stages of the analytical pipeline by computational ophthalmology specialists.â¢It is robust to noise and low-quality images.â¢Output provides an ideal scenario for down-the-line analysis by facilitating only relevant pixels in a digital fundoscopy.
RESUMO
Resumen: El tratamiento quirúrgico de las fracturas desplazadas del tercio medio de clavícula ha ganado popularidad durante la última década, ya que permite acortar el período de recuperación, acelerando la reincorporación laboral y deportiva, al mismo tiempo que disminuye significativamente el riesgo de no unión. Sin embargo, las molestias relacionadas con el abordaje cutáneo como dolor e irritación a nivel de la cicatriz, las alteraciones sensitivas persistentes (hipoestesia, hiperestesia o disestesias) y la inconformidad cosmética continúan siendo motivo de preocupación por parte de los pacientes, alterando su percepción subjetiva del resultado quirúrgico obtenido. En tiempos recientes la técnica mínimamente invasiva se ha descrito para el manejo de este tipo de fracturas, demostrando reducir las posibles complicaciones de la técnica tradicional abierta mientras que mantiene sus principales beneficios, optimizando además la capacidad biológica reparativa de la clavícula, ya que respeta la vascularización del foco de fractura. El objetivo de este artículo es describir paso a paso la técnica quirúrgica mínimamente invasiva para el manejo de fracturas desplazadas del tercio medio de clavícula, reportando además los resultados clínicos obtenidos en una serie de casos intervenidos con esta técnica.
Abstract: Surgical management of displaced midshaft clavicular fractures has gained popularity in the last decade due to reductions in functional recovery times and lower rates of nonunion. However, several complications related to the open approach have been described and remain concerning for patients. These potential sequelae include scar pain, local irritation, peri-incisional numbness, and cosmetic deformity, all of which may contribute to unsatisfactory subjective outcomes. Recently, minimally invasive plate osteosynthesis (MIPO) technique has been described for the treatment of these fractures. This approach presents the opportunity to reduce shortcomings of the traditional open approach while maintaining its benefits, respecting the biological healing environment and preserving blood supply to the fracture site. The purpose of this study is to provide a step-by-step description of the MIPO surgical technique for management of displaced midshaft clavicular fractures and report the clinical outcomes of a case series using this technique.
RESUMO
Surgical management of displaced midshaft clavicular fractures has gained popularity in the last decade due to reductions in functional recovery times and lower rates of nonunion. However, several complications related to the open approach have been described and remain concerning for patients. These potential sequelae include scar pain, local irritation, peri-incisional numbness, and cosmetic deformity, all of which may contribute to unsatisfactory subjective outcomes. Recently, minimally invasive plate osteosynthesis (MIPO) technique has been described for the treatment of these fractures. This approach presents the opportunity to reduce shortcomings of the traditional open approach while maintaining its benefits, respecting the biological healing environment and preserving blood supply to the fracture site. The purpose of this study is to provide a step-by-step description of the MIPO surgical technique for management of displaced midshaft clavicular fractures and report the clinical outcomes of a case series using this technique.
El tratamiento quirúrgico de las fracturas desplazadas del tercio medio de clavícula ha ganado popularidad durante la última década, ya que permite acortar el período de recuperación, acelerando la reincorporación laboral y deportiva, al mismo tiempo que disminuye significativamente el riesgo de no unión. Sin embargo, las molestias relacionadas con el abordaje cutáneo como dolor e irritación a nivel de la cicatriz, las alteraciones sensitivas persistentes (hipoestesia, hiperestesia o disestesias) y la inconformidad cosmética continúan siendo motivo de preocupación por parte de los pacientes, alterando su percepción subjetiva del resultado quirúrgico obtenido. En tiempos recientes la técnica mínimamente invasiva se ha descrito para el manejo de este tipo de fracturas, demostrando reducir las posibles complicaciones de la técnica tradicional abierta mientras que mantiene sus principales beneficios, optimizando además la capacidad biológica reparativa de la clavícula, ya que respeta la vascularización del foco de fractura. El objetivo de este artículo es describir paso a paso la técnica quirúrgica mínimamente invasiva para el manejo de fracturas desplazadas del tercio medio de clavícula, reportando además los resultados clínicos obtenidos en una serie de casos intervenidos con esta técnica.
Assuntos
Clavícula , Fraturas Ósseas , Placas Ósseas , Clavícula/cirurgia , Fixação Interna de Fraturas/métodos , Consolidação da Fratura , Fraturas Ósseas/cirurgia , Humanos , Procedimentos Cirúrgicos Minimamente Invasivos/métodos , Resultado do TratamentoRESUMO
RESUMEN Objetivo. Identificar la presencia del virus del Oeste del Nilo en equinos y mosquitos en ocho municipios del departamento del Meta. Materiales y métodos. La investigación contó con el aval del Comité de bioética de la Universidad de los Llanos. Se analizaron mediante pruebas serológicas y moleculares 613 muestras de equinos criollos y de raza cuarto de milla, destinados a actividades deportivas y de trabajo, con un rango de edad de 2 a 15 años, en los transectos: Villavicencio-Restrepo-Cumaral, San Martín - Castilla la Nueva-Granada y Puerto López-Puerto Gaitán, analizados en 62 pool y 213 mosquitos. Los pool de sueros de equinos y mosquitos fueron analizados por ELISA y PCR. Resultados. No se encontraron animales seropositivos mediante la prueba de ELISA y las pruebas moleculares también fueron negativas. Conclusiones. Aunque en este estudio no se evidenció la presencia de anticuerpos IgM por la técnica de Elisa y las pruebas moleculares (RT-PCR) también fueron negativas para circulación viral, en los municipios objeto de estudio, es importante indicar que la detección molecular en sueros, requiere unos niveles de viremia representativos y que el animal se encuentre en la fase aguda de la enfermedad. Aunque es posible que la población equina se mantenga libre de contacto con el virus, se debe mantener la vigilancia epidemiológica frente a este importante patógeno para la salud humana, especialmente por la presentación de brotes de otros virus zoonóticos como la Encefalitis Equina del Este y Encefalitis Equina Venezolana en los departamentos del Meta y Casanare, contiguo a este.
ABSTRACT Objective. Identify the presence of West Nile virus in horses and mosquitoes in eight municipalities of the department of Meta. Materials and methods. The research was supported by the Bioethics Committee of the University of Los Llanos. 613 samples of Creole and quarter-mile equine horses, intended for sports and work activities, with an age range of 2 to 15 years, were analyzed using serological and molecular tests in the transects: Villavicencio-Restrepo-Cumaral, San Martín- Castilla la Nueva-Granada and Puerto López-Puerto Gaitán, analyzed in 62 pools and 213 mosquitoes. The pool of sera of horses and mosquitoes were analyzed by ELISA and PCR. Results. No seropositive animals were found by the ELISA test and molecular tests were also negative. Conclusions. Although in this study the presence of IgM antibodies was not evidenced by the Elisa technique, and molecular tests (RT-PCR) were also negative for viral circulation, in the municipalities under study, it is important to indicate that the molecular detection in sera, it requires representative levels of viremia and that the animal is in the acute phase of the disease. Although it is possible that the equine population remains free of contact with the virus, epidemiological surveillance should be maintained against this important pathogen for human health, especially due to the outbreak of other zoonotic viruses such as Eastern Equine Encephalitis and Encephalitis Venezuelan Equine in the departments of Meta and Casanare, adjacent to this.
Assuntos
Animais , Vírus do Nilo Ocidental , Zoonoses , Reação em Cadeia da Polimerase , Monitoramento Epidemiológico , FlavivirusRESUMO
AIMS: To calculate fermentation efficiency in a continuous ethanol production process, we aimed to develop a robust mathematical method based on the analysis of metabolic by-product formation. METHODS AND RESULTS: This method is in contrast to the traditional way of calculating ethanol fermentation efficiency, where the ratio between the ethanol produced and the sugar consumed is expressed as a percentage of the theoretical conversion yield. Comparison between the two methods, at industrial scale and in sensitivity studies, showed that the indirect method was more robust and gave slightly higher fermentation efficiency values, although fermentation efficiency of the industrial process was found to be low (~75%). CONCLUSIONS: The traditional calculation method is simpler than the indirect method as it only requires a few chemical determinations in samples collected. However, a minor error in any measured parameter will have an important impact on the calculated efficiency. In contrast, the indirect method of calculation requires a greater number of determinations but is much more robust since an error in any parameter will only have a minor effect on the fermentation efficiency value. SIGNIFICANCE AND IMPACT OF THE STUDY: The application of the indirect calculation methodology in order to evaluate the real situation of the process and to reach an optimum fermentation yield for an industrial-scale ethanol production is recommended. Once a high fermentation yield has been reached the traditional method should be used to maintain the control of the process. Upon detection of lower yields in an optimized process the indirect method should be employed as it permits a more accurate diagnosis of causes of yield losses in order to correct the problem rapidly. The low fermentation efficiency obtained in this study shows an urgent need for industrial process optimization where the indirect calculation methodology will be an important tool to determine process losses.
Assuntos
Bactérias/metabolismo , Etanol/metabolismo , Microbiologia Industrial/métodos , Bactérias/química , Etanol/análise , Fermentação , Modelos TeóricosRESUMO
A solitary tuberculous brain lesion (STBL) can be difficult to distinguish from a glioma, metastasis or other infectious disease, especially from a pyogenic brain abscess. We analyzed the clinical characteristics, diagnostic procedures and outcomes of 24 patients with STBL diagnosed in three centers from France, India and Mexico. We also reviewed 92 STBL cases previously reported in the literature. General symptoms were found in 54% of our patients, including enlarged lymph nodes in 20%. Cerebrospinal fluid was typically abnormal, with lymphocytic pleocytosis and a high protein level. The lung CT scan was abnormal in 56% of patients, showing lymphadenopathy or pachipleuritis. Brain MRI or CT was always abnormal, showing contrast-enhanced lesions. Typically, MRI abnormalities were hypointense on T1-weighted sequences, while T2-weighted sequences showed both a peripheral hypersignal and a central hyposignal. The diagnosis was documented microbiologically or supported histologically in 71% of cases. Clinical outcome was good in 83% of cases.
Assuntos
Tuberculoma Intracraniano/epidemiologia , Adolescente , Adulto , Idoso , Antituberculosos/uso terapêutico , Abscesso Encefálico/diagnóstico , Neoplasias Encefálicas/diagnóstico , Comorbidade , Diagnóstico Diferencial , Feminino , Febre/etiologia , França/epidemiologia , Glioma/diagnóstico , Cefaleia/etiologia , Humanos , Índia/epidemiologia , Imageamento por Ressonância Magnética , Masculino , México/epidemiologia , Pessoa de Meia-Idade , Marrocos/etnologia , Mycobacterium tuberculosis/isolamento & purificação , Avaliação de Sintomas , Tomografia Computadorizada por Raios X , Tuberculoma Intracraniano/diagnóstico , Tuberculoma Intracraniano/tratamento farmacológico , Tuberculoma Intracraniano/patologia , Tuberculose Pulmonar/diagnóstico por imagem , Tuberculose Pulmonar/epidemiologia , Adulto JovemRESUMO
OBJETIVOS: determinar la incidencia de la morosidad de las cuentas por cobrar en la rentabilidad y liquidez de la Empresa Social del Estado Hospital Universitario Erasmo Meoz, período 2005-2009, realizada en la ciudad de Cúcuta, Departamento Norte de Santander, Colombia. METODOLOGIA: se aplicó una investigación de tipo documental, para determinar y analizar los indicadores financieros referentes a la morosidad de las cuentas por cobrar, rentabilidad y liquidez; por lo tanto, se requirió de la revisión y consulta detallada de fuentes primarias (estados financieros e informes) de la Empresa Social del Estado Hospital Universitario Erasmo Meoz período 2005 - 2009 RESULTADOS: en particular, se evidenció el crecimiento acelerado de los costos y los gastos sin ningún control con respecto al aumento en las ventas, igualmente el crecimiento de las cuentas por cobrar, lo cual incidió directamente en la sostenibilidad financiera del Hospital. DISCUSION: ante la problemática que refleja el Hospital por la alta morosidad de cartera y la insostenibilidad financiera, la Institución requiere con urgencia promover lineamientos y estrategias financieras que conduzcan al mejoramiento de la competitividad y oportunidad en la prestación de servicios de salud de tercer y cuarto nivel de complejidad, beneficiándose los usuarios más pobres de la región y su área de influencia.
OBJECTIVE: to determine the incidence of delinquent accounts receivable on the profitability and liquidity of the Erasmo Meoz University Hospital State Social Enterprise, 2005-2009 period, carried out in the city of Cúcuta, Norte de Santander Department, Colombia. METHODOLOGY a documentary research was carried out in order to determine and analyze the financial indicators referring to delinquent accounts receivable, profitability and liquidity; however a detailed review and inquiry into the primary sources (financial statements and reports) for the Erasmo Meoz University Hospital State Social Enterprise in the 2005-2009 period was required. RESULTS: pin particular there was accelerated growth of costs and expenses with no control with respect to a rise in sales. Likewise the accounts receivable grew, directly impacting the Hospital's financial sustainability. DISCUSSION: faced with the problem reflected by the Hospital in its high portfolio delay in payment of liabilities and financial unsustainability, the Institution urgently needs to introduce guidelines and financial strategies which promote greater competition and opportunity in the provision third and fourth level of complexity healthcare services, thus benefiting the region's poorer residents and its area of influence.
RESUMO
AIM: To assess the prevalence of C-shaped canal systems in mandibular second molars, in samples of modern and pre-Hispanic Mayan individuals in Yucatán, Mexico, and to analyse the trait through time and attempt to find new evidence of ethnical bonds between populations. METHODOLOGY: Three hundred and forty-one randomly selected patients were treated in the Endodontic Clinic at the Dental school of the Universidad Autónoma de Yucatán, and 48 mandibular second molars from pre-Hispanic Mayan collections were macroscopically and radiographically inspected. Statistical analysis was performed with a Fisher's exact test to compare the prevalence of C-shaped canal systems in modern and archaeological samples. RESULTS: In the clinical observation, 118 of 341 (35%) patients treated endodontically had C-shaped mandibular second molars. In the radiographical evaluation, 17 of 48 (35%) archaeological molars had fused roots and pulp chamber morphology categorized as C-shaped. There were no significant differences between the frequencies in both samples. CONCLUSION: This study highlighted that a one-rooted mandibular molar was likely to have a C-shaped canal. The similarity between ancient and modern samples indicates that the genetic make-up since the European conquest has not affected the expression of this trait. This study supports the theory that the Mayan population has a relationship with the Northeast Asian population.
Assuntos
Endodontia , Fósseis , História Antiga , Humanos , MéxicoRESUMO
Introducción: La hipoacusia sensorioneural bilateral profunda es la tercera causa de discapacidad en Chile, con una incidencia de entre 1 a 3 casos por cada 1.000 nacidos vivos, siendo muchos casos susceptibles de ser tratados mediante implante coclear. Objetivo: Describir resultados de la cohorte de pacientes implantados en el Hospital Barros Luco Trudeau. Material y método: Estudio de cohorte retrospectiva. Se reportan los resultados de la totalidad de pacientes implantados en el período 2003-2011. Resultados: Fueron implantados 80pacientes. La mediana de edad de implantación fue 48 meses. Treinta y siete (46,25%) pacientes fueron mujeres, 7 (8,75%) fueron prematuros, y 14 (17,5%) tenían el antecedente de meningitis bacteriana. Sesenta y ocho (85%) fueron diagnósticos prelinguales, 9 (11,25%) poslinguales, y 3 (3,75%) perilinguales. El PTP promedio prequirúrgico fue 111,82 dB, y el posquirúrgico con implante 25,36 dB (p <0,0001). Respecto a integración, el 100% de los pacientes poslinguales, el 67,7% de los prelinguales, y el 100% de los perilinguales se encuentran integrados a sus actividades. Se ha observado el 5% de complicaciones: una parálisis facial, un hematoma infectado y dos alergias a cera de hueso. Conclusión: Los resultados de este programa son altamente satisfactorios. Todos los pacientes se encuentran en seguimiento hasta la fecha con una buena adherencia terapéutica y rehabilitación. La evaluación de este programa permite plantear que debería ampliarse.
Introduction: Profound bilateral sensorioneural hearing loss is the third leading cause of disability in Chile, with an incidence of 1 to 3 cases for every 1.000 born, which may be managed with cochlear implants. Aim: Describe results of the cohort of patients implanted at Barros Luco Trudeau Hospital. Material and method: Retrospective cohort study. We report the results of all patients implanted in the period from 2003 to 2011. Results: 80 patients were implanted. The median age at implantation was 48 months. 37 (46.25%) patients were female, 7 (8.75%) were premature, and 14 (17.5%) had a history of bacterial meningitis. 68 (85%) were prelingual diagnosed, 9 (11.25%) post-lingual, and 3 (3.75%) perilinguals. The average preoperative PTP was 111.82 dB, and postoperative was 25.36 dB (p <0.0001). Regarding integration, 100% of postlingual patients, 67.7% of prelingual, and 100% of perilinguales are fully integrated into their activities. There have been 5% complications: one facial paralysis, one infected hematoma, and two bone wax allergies. Conclusion: The results of this program are highly satisfactory. All patients are up to date with good adherence and rehabilitation. The evaluation of this program allows us to suggest that should be expanded.
Assuntos
Humanos , Masculino , Feminino , Pré-Escolar , Adulto , Implante Coclear/estatística & dados numéricos , Perda Auditiva Neurossensorial/cirurgia , Avaliação de Programas e Projetos de Saúde , Chile , Estudos Retrospectivos , Estudos de Coortes , Resultado do TratamentoRESUMO
In August 2010, lesions similar to those reported for target spot were observed on Nicotiana tabacum L. plants produced in float systems in Cerrillos, Salta, Argentina. Tobacco leaves with characteristic lesions were collected from different locations in Cerrillos, Salta. Symptoms ranged from small (2 to 3 mm), water-soaked spots to larger (2 to 3 cm), necrotic lesions that had a pattern of concentric rings, tears in the centers, and margins that often resulted in a shot-hole appearance. Isolation of the causal agent was made on potato dextrose agar (PDA) acidified to pH 5 with 10% lactic acid and incubated at 25 ± 2°C in darkness for 2 to 3 days. Hyphal tips were transferred to a new medium and the cultures were examined for morphological characters microscopically (3). Eight isolates were obtained. The rapid nuclear-staining procedure using acridine orange (3) was used to determine the number of nuclei in hyphal cells. Multinucleate hyphae were observed, with 4 to 9 nuclei per cell. Molecular characterization was conducted by examining the internal transcribed spacer (ITS) region from all of the isolates of the pathogen identified as Rhizoctonia solani based on morphological characteristics (1). Fragments amplified using primers ITS1 (5'TCCGTAGGTGAACCTGCGG3') and ITS4 (5'TCCTCCGCTTATTGATATGC3') (4) were sequenced and compared with R. solani anastomosis group (AG) sequences available in the NCBI GenBank database. Sequence comparison identified this new isolate as R. solani anastomosis group AG 2-1. Previous isolates of target spot were identified as AG 3 (2). The isolates that were studied were deposited in the "Laboratorio de Sanidad Vegetal" INTA-EEA-Salta Microbial Collection as Rs59c, Rs59b, Rs59, Rs66, Rs67, Rs68, Rs69, and Rs70. The ITS nucleotide sequence of isolate Rs59 has been assigned the GenBank Accession No. JF792354. Pathogenicity tests for each isolate were performed using tobacco plants grown for 8 weeks at 25 ± 2°C with a 12-h photoperiod. Ten plants were inoculated by depositing PDA plugs (0.2 cm) colonized with R. solani onto leaves; plants inoculated with the pure PDA plug without pathogen served as controls. The plants were placed in a 25 ± 2°C growth chamber and misted and covered with polyethylene bags that were removed after 2 days when plants were moved to a glasshouse. After 48 h, symptoms began as small (1 to 2 mm), circular, water-soaked spots, lesions enlarged rapidly, and often developed a pattern of concentric rings of 1 to 2 cm. After 8 days, all inoculated plants showed typical disease symptoms. Morphological characteristics of the pathogen reisolated from symptomatic plants were consistent with R. solani. Control plants remained healthy. These results correspond to the first reports of the disease in the country. Compared to other areas in the world, target spot symptoms were only observed in tobacco plants produced in float systems and were not observed in the field. The prevalence of the disease in Salta, Argentina was 7%. To our knowledge, this is the first report of R. solani AG2.1 causing target spot of tobacco. References: (1) M. Sharon et al. Mycoscience 49:93, 2008. (2) H. Shew and T. Melton. Plant Dis. 79:6, 1995. (3) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St. Paul, MN, 1991. (4) T. J. White et al. Page 282 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.