RESUMO
Cellular and humoral responses were evaluated in Litopenaeus vannamei juveniles when exposed to malathion, endosulfan, and their mixture. Each experiment was performed in the hemolymph collected at each exposure time (5 and 96â¯h) in duplicate; total hemocyte count, coagulation time, hemocyanin concentration, phenoloxidase (PO) and superoxide dismutase (SOD) activities were quantified. Survival was not affected by pesticides applied individually and mixed. Clotting time did not show significant differences concerning increase of concentration percentage of the pesticides tested. In organisms exposed to the pesticide mixture, hemocyanin decreased at 5â¯h of exposure as the concentration increased. Only in the malathion experiment did exposed shrimp to 10 and 50% of the LC50-96â¯h show significantly (pâ¯<â¯0.05) higher hemocyte contents. For malathion, significantly (pâ¯<â¯0.05) lower PO values in shrimp exposed to higher concentrations (10 and 50% of the LC50-96â¯h) were determined. While for the mixture treatment, high SOD value was determined at high exposure time and concentration. Malathion was the pesticide that showed an effect on some variables even at sublethal concentrations. The Continuous Concentration Criteria of the United States Environmental Protection Agency did not represent effects on the variables when they were compared with the averages of the control group.
Assuntos
Endossulfano/toxicidade , Imunidade Celular/efeitos dos fármacos , Imunidade Humoral/efeitos dos fármacos , Malation/toxicidade , Penaeidae/efeitos dos fármacos , Animais , Sinergismo Farmacológico , Hemocianinas/sangue , Hemócitos/efeitos dos fármacos , Hemócitos/imunologia , Hemolinfa/efeitos dos fármacos , Hemolinfa/imunologia , Monofenol Mono-Oxigenase/metabolismo , Penaeidae/imunologiaRESUMO
The chemical characteristics of mine tailings, organic amendments (doses), and plants are the critical factors that must be evaluated and monitored to ensure the sustainability of phytostabilization. The aim of this study was to evaluate the mobility of copper (Cu) in mine tailings (MT) of the Zone Central of Chile to which commercial humic substances were added, examining their effect on the uptake of Atriplex halimus. Two commercial humic substances (HS1 and HS2) extracted from leonardite (highly oxidized lignite), of different pH and total organic carbon, were evaluated by adsorption curve for Cu. In columns, soluble Cu, pH, and electrical conductivity in leachates were evaluated for MT, MT + HS1, and MT + HS2, and HS1 and HS2 in doses of 120 mg kg-1. In pot assay, seeds were germinated directly in MT and cultivated for 140 days with the addition of HS2 in 120 and 240 mg kg-1. Mine tailing presents high concentration of Cu (2016 ± 223 mg kg-1, pH 6.3 ± 0.1). The results of sequential extraction indicate that Cu is associated with the sulfide fraction of low risk of mobility. The amount of Cu sorbed by HS1 was higher than that sorbed by HS2, and both humic substances showing better fit to the Freundlich than Langmuir model. Lixiviation of Cu was significantly lower in MT + HS1 (0.166 ± 0.043 mg kg-1) and MT + HS2 (0.157 ± 0.018 mg kg-1) than in MT (0.251 ± 0.052 mg kg-1). Copper concentration in plants reached 185.8 ± 37.8 mg kg-1 in the roots and 32.6 ± 7.4 mg kg-1 in the aerial parts cultivated in MT without effect of the humic substance addition in Cu uptake nor growth. Copper concentrations in the aerial parts were adjusted to sufficient or normal levels in plant. A good management of mine tailings through phytostabilization could consider an adequate mixture of humic substances (to avoid leaching of metals) and an organic amendment that provides essential nutrients and increases biomass generation.
Assuntos
Atriplex/química , Atriplex/metabolismo , Monitoramento Ambiental/métodos , Substâncias Húmicas/análise , Poluentes do Solo/análise , Solo/química , Adsorção , Biodegradação Ambiental , Biomassa , Chile , Cobre/análise , Minerais/química , Mineração , Plantas/químicaRESUMO
In fall 2014, 5 to 75% percent of chili and bell pepper (Capsicum annuum L.) in commercial fields located in the Mexican states of Durango, Zacatecas, and Michoacán had symptoms of deformed, small, mosaic, curled, and chlorotic leaves; shortened internodes; plant dwarfing; or phyllody and rosetting leaf tips. At the same time, leafhoppers and psyllids were observed in the fields, and more than 50 beet leafhoppers (Circulifer tenellus) and nearly 300 potato psyllids (Bactericera cockerelli) were collected from the pepper plants and adjacent weeds. Based on the insect pressure and observed symptoms, nearly 400 pepper samples were collected across this region of Mexico and tested for the presence of leafhopper- and psyllid-associated pathogens. In all, 76% of the pepper samples were found to be infected with 'Candidatus Liberibacter solanacearum', beet leafhopper-transmitted virescence agent (BLTVA) phytoplasma, a strain of a curtovirus, or a combination of any two or three of these pathogens. Additionally, 77% of the collected leafhoppers and 40% of the psyllids were infected with one or more of these pathogens, in addition to Spiroplasma citri. Specifically, the leafhoppers were infected with BLTVA phytoplasma, S. citri, or a strain of curtovirus. Of particular interest, potato psyllids were not only infected with 'Ca. L. solanacearum' but also with phytoplasmas that belong to the groups 16SrVI subgroup A and 16SrI subgroup A. The presence of mixed infections in pepper plants and the insect vectors highlights the need for growers to effectively control both leafhoppers and potato psyllids from solanaceous crops in this region of Mexico in order to prevent the spread of these bacterial and viral pathogens.
Assuntos
Capsicum/microbiologia , Geminiviridae/isolamento & purificação , Hemípteros/microbiologia , Phytoplasma/isolamento & purificação , Doenças das Plantas/microbiologia , Rhizobiaceae/isolamento & purificação , Animais , Hemípteros/virologia , Insetos Vetores/microbiologia , Insetos Vetores/virologia , México , Doenças das Plantas/virologiaRESUMO
The mercury content of mullets and black mojarras of Urías lagoon (NW Mexico) were determined every second month from November 2012 to September 2013, to determine differences related to season or to trophic levels. The Hg contents of the muscle were significantly higher in mojarras, confirming that Hg contents tend to increase along the food chain, while the levels in liver were higher in mullets, suggesting different Hg storage strategies of these species. In mullets, the content of muscles did not vary seasonally and was significantly lower than in the liver. In black mojarras there were no significant differences between muscle and liver, and the lowest mean values were in May in both tissues. Given the low Hg contents, both species are safe for human consumption, but care should be taken in traditional fishing communities.
Assuntos
Monitoramento Ambiental , Mercúrio/metabolismo , Perciformes/metabolismo , Smegmamorpha/metabolismo , Poluentes Químicos da Água/metabolismo , Animais , Peixes , Cadeia Alimentar , Mercúrio/análise , Mercúrio/toxicidade , México , Músculos/química , Estações do Ano , Poluentes Químicos da Água/toxicidadeRESUMO
We aimed to determine whether the daily exchange of photo-stimulated males among subgroups of females improved the reproductive response of anestrous goats exposed to males. Bucks were rendered sexually active during the rest season by exposure to 2.5 months of long days from November 1st. In April, males (n=3) were put in contact with three subgroups of anestrous goats (one male per 12 females) where they remained throughout the study, constituting the fixed-group. Other males (n=3) were put in contact with three subgroups of females (one male per 11-12 females) and were rotated daily among them, constituting the rotated-group. The sexual behavior of all males was registered from 08:00 to 09:00 on days 0, 1, 2, and 8 after exchanging the males from the subgroups of females. Ovulation and pregnancy rates were determined by transrectal ultrasonography. The occurrences of ano-genital sniffing, nudging (days 1, 2, and 8), and mounting attempts (days 2 and 8) were greater in the rotated than in the fixed-group (P<0.01). The proportions of females that ovulated did not differ among goats from the fixed (92%) and rotated-group (94%; P>0.05). The proportion of pregnant females and the fertility at kidding did not differ between those from the rotated (79% and 59%) and fixed-group (83% and 61%; P>0.05). We conclude that the daily exchange of photo-stimulated males among subgroups induced an increase of their sexual behavior, but does not improve the pregnancy rates in seasonal anestrous goats.
Assuntos
Cabras/fisiologia , Luz , Comportamento Sexual Animal/fisiologia , Animais , Feminino , Fertilidade/efeitos da radiação , Masculino , Gravidez , Taxa de Gravidez , Comportamento Sexual Animal/efeitos da radiaçãoRESUMO
In August 2009, yellowing, upward curling of leaves, and stunted growth were observed on 15 to 40% of dry bean (Phaseolus vulgaris cv. Aluvori) plants in each of several experimental fields in Zacatecas, Mexico. Symptoms and presence of the beet leafhopper (Circulifer tenellus) in affected fields suggested an infection by curtoviruses (Geminiviridae). Total DNA extracts from 18 plant samples exhibiting symptoms were obtained by a modified Dellaporta method (2) and subjected to PCR analysis using two pairs of new, degenerate primers specific for curtoviruses: RepQEW-for (CCRAARTAAGMATCRGCCCAYTCTTG) in combination with CP450-rev (GTCCTCGAGTAGACGGCATAGCCTGACC) and V2Gen910-for (ATGTCGACGAAGCATTTGAAGTTTGATATGGC) with Rep2GQ-rev (GAAGATCTGCWCGMGGAGGYCARCAGACGGCT). This double set of primers was used to amplify two overlapping DNA segments encompassing the complete curtovirus genome. All samples produced amplicons of the expected size (1.75 and 1.8 kb, respectively) that were cloned into pGEM-T Easy Vector (Promega, Madison, WI). Restriction fragment length polymorphism analysis of PCR clones with EcoRI and HinfI endonucleases suggested the presence of a single curtovirus species because only one restriction fragment pattern was observed in all cases. Viral amplicons from three plants were sequenced, and the overlapping DNA fragments were subsequently assembled into a complete genome sequence. Comparison of the virus sequence (Accession No. HQ634913) with sequences of all curtovirus isolates available in GenBank showed that it shared the highest nucleotide identity (98%) with Beet mild curly top virus-Mexico SLP1 from pepper (BMCTV-MX [SLP1]; Accession No. EU586260). Amino acid sequence identity of the seven predicted proteins (Rep, TrAP, REn, C4, V1, V2, and V3) encoded by the virus isolated from bean plants shared 98.0, 97.3, 98.5, 98.8, 100, 99.2, and 97.8% sequence identity, respectively, with the homologous proteins of BMCTV-MX [SLP1]. A BMCTV isolate from pepper collected in Zacatecas in 2007 (Accession No. EU586260) with 96% nucleotide sequence identity to the curtovirus identified in bean induced symptoms in P. vulgaris cv. Topcrop similar to those observed in bean in Zacatecas (1). To determine the presence of curtoviruses in the local populations of insect vectors, beet leafhoppers were collected in one of the sampled dry bean fields and total DNA was isolated from a pool of approximately 20 insects. Amplification of viral DNA with the degenerate primers RepQEW-for and CP450-rev and further sequencing of the PCR products confirmed the presence of a curtovirus DNA sharing almost identical nucleotide identity (99%) with the DNA isolated from bean plants. In 2011, symptoms similar to those observed in bean in 2009 occurred in approximately 30% of dry bean plants, suggesting that BMCTV is endemic in the Zacatecas Region. To our knowledge, this is the first report of BMCTV in legumes in Mexico. References: (1) L. F. Chen et al. Arch. Virol. 156:547, 2011. (2) S. L. Dellaporta et al. Plant Mol. Biol. Rep. 1:19, 1983.
RESUMO
BACKGROUND: Reflux Esophagitis is a common complaint from the upper gastrointestinal tract with a figured out prevalence of about 2%. Therapeutic results in this pathology have been unsatisfactory. AIM: To compare lansoprazole and omeprazole therapeutic effects in patients with reflux esophagitis. MATERIALS AND METHODS: A clinical, double-blinded, balanced survey was randomly designed with patients who would daily receive 30 mg lansoprazole (Group A) or 20 mg omeprazole (Group B) during a 4-week period. All patients were submitted to endoscopy and biopsy both at the beginning and at the end of the survey. RESULTS: Ten patients in each group were treated without any significant differences in sex, age, nicotinism, alcoholism, AINES ingestion, development time, pain regurgitations, pyrrosis, hematemesis, dysphagia, melena, nausea or vomiting, and esophagitis degree. A complete cure in 8/10 (omeprazole) and 7/10 (lansoprazole) patients was obtained (p = n.s.). However, the histological results of the biopsy at the end of the four-week period proved to be a failure in 4/10 (omeprazole) and in 5/10 (lansoprazole) patients (p = n.s.). The endoscopy and clinical result at the end of the study were similarly effective; but not so the histological damage to the esophagus, which continues to be important. CONCLUSIONS: The use of bomb inhibitors in esophagitis by reflux is advisable. Future surveys must assess the average time of treatment for the disappearance of the histologic lesion.
Assuntos
Antiulcerosos/uso terapêutico , Inibidores Enzimáticos/uso terapêutico , Esofagite Péptica/tratamento farmacológico , Omeprazol/análogos & derivados , Omeprazol/uso terapêutico , 2-Piridinilmetilsulfinilbenzimidazóis , Adolescente , Adulto , Idoso , Antiulcerosos/administração & dosagem , Interpretação Estatística de Dados , Método Duplo-Cego , Inibidores Enzimáticos/administração & dosagem , Esofagite Péptica/complicações , Esofagite Péptica/diagnóstico , Esofagoscopia , Feminino , Humanos , Lansoprazol , Masculino , Pessoa de Meia-Idade , Omeprazol/administração & dosagem , Fatores de TempoRESUMO
To assess a possible free-radical scavenging action of taurine during coronary artery bypass grafting, 12 patients were randomly divided into two equal groups. One to 3 hours before surgery, they received a rapid intravenous infusion of either placebo (group 1) or taurine (5 gm) (group 2). During surgery, biopsy samples were taken before ischemia (preischemic samples) and after 10 minutes of reperfusion (reperfusion samples). Lipoperoxidation was determined by hydroperoxide-initiated chemiluminescence of heart homogenates, and myocardial cell damage was assessed by electron microscopy. The values for chemiluminescence in preischemic and reperfusion samples from group 1 were 7500 +/- 1600 and 18,600 +/- 4600 cpm/mg of protein, respectively (p less than 0.03). This difference was not observed in group 2 where the values were 10,050 +/- 2700 and 11,800 +/- 4200 cpm/mg of protein, for preischemic and reperfusion samples, respectively. The number of severely damaged mitochondria (grades 3 and 4) in reperfusion samples from group 1 increased significantly compared to preischemic samples (25 +/- 8% vs 12 +/- 3%, p less than 0.01). Conversely no differences were observed between the number of severely damaged mitochondria in reperfusion and preischemic samples from group 2 (8 +/- 3% vs 8 +/- 2%). The number of damaged and necrotic myocytes increased in group 1 after reperfusion from 22 +/- 9% to 34 +/- 10% (p less than 0.03) and from 10 +/- 7% to 26 +/- 20% (p = NS), respectively. No changes were observed between reperfusion and preischemic samples in group 2. Treatment with taurine seems to reduce lipoperoxidation and decrease cell damage at the time of reperfusion.