RESUMO

Reports of pancreatic pseudocyst drainage during metabolic bariatric surgery are extremely rare. Our patient is a 38-year-old female suffering from obesity grade IV and presents a persistent symptomatic pancreatic pseudocyst 8 months after an episode of acute biliary pancreatitis. After an extensive evaluation and considering other treatment options, our multidisciplinary team and the patient decided to perform a one-stage procedure consisting of laparoscopic cystogastrostomy, cholecystectomy, and one-anastomosis gastric bypass. After bringing the patient to the operating room, the surgeon performed an anterior gastrostomy to access the stomach's posterior wall, followed by a 6-cm cystogastrostomy on both the stomach's posterior wall and the cyst. Next, a cholecystectomy which involved dissecting the triangle of Calot was performed. Then, an 18-cm gastric pouch using a 36-Fr calibration tube was created. The cystogastrostomy was left in the remaining stomach. Finally, gastrojejunal anastomosis is done. The patient's postoperative course proceeded smoothly, leading to her home discharge on the third postoperative day. At the 1-year follow-up, the patient had lost 56 kg and was symptom-free; a computer tomography scan showed that the pancreatic pseudocyst had resolved. This case shows a video of a successful laparoscopic cystogastrostomy, cholecystectomy, and one-anastomosis gastric bypass (OAGB) used to treat persistent abdominal pain and obesity grade IV. We also conduct a bibliographic review.

Assuntos

RESUMO

Plants belonging to the genera Astragalus, Oxytropis, Ipomoea, Sida, and Swainsona often contain the toxin swainsonine (SW) produced by an associated fungal symbiont. Consumption of SW-containing plants causes a serious neurological disorder in livestock, which can be fatal. In this study, a fungal endophyte, Alternaria section Undifilum, was identified in Astragalus garbancillo seeds, using polymerase chain reaction (PCR) followed by direct sequencing. In seeds, the SW concentrations were about 4 times higher than in other parts of the plant. Furthermore, microscopic examination demonstrated that the fungus mycelium grows inside the petioles and stems, on the outer surface and inside the mesocarp of the fruit, in the mesotesta and endotesta layers of the seed coat, and inside the endosperm of the seeds. Our results support the notion that the SW-producing fungus is vertically transmitted in the host plant A. garbancillo.

Assuntos

RESUMO

Ejecutar procesos efectivos de búsqueda de casos de tuberculosis es crucial para acele-rar el paso hacia su eliminación. El empeoramiento de las condiciones económicas mun-diales y nacionales no nos permite aplicar extensivamente las tecnologías rápidas mo-leculares idóneas de diagnóstico. Consideramos sensato entonces aplicar algoritmos alternativos que satisfagan las necesidades nacionales presentes hasta que las condi-ciones permitan la cobertura completa de las tecnologías moleculares recomendadas. Sugerimos introducir la radiografía digital para todos los algoritmos, utilizar mejor la microscopía de fluorescencia LED y la óptica convencional ya probadas. En conclusión, es preciso que este enfoque de trabajo, que procura optimizar la efectividad y eficiencia del programa, se introduzca en la práctica cotidiana hasta que lo idóneo sea permisible

Executing effective tuberculosis case-finding processes is crucial to accelerate the path towards elimination of the disease. The worsening of global and national economic conditions do not allow us to extensively apply rapid molecular diagnostic technolo-gies. We consider it sensible and necessary to apply alternative algorithms that meet the current national needs, until conditions allow full coverage of the recommended molecular technologies. We suggest introducing digital X-rays for all algorithms, bet-ter use of LED fluorescence microscopy and conventional optics already appropriate-ly tested. In conclusion, it is necessary that this approach that seeks to optimize the effectiveness and efficiency of the Cuban program be introduced into daily practice until the ideal is permissible

Assuntos

RESUMO

The first rice virus detected in Argentina was Rice stripe necrosis virus (RSNV), a benyvirus known to cause "entorchamiento" due to its characteristic symptom of leaf crinkling. As part of this study, it was proposed to sequence plants naturally infected with RSNV that presented another symptom such as thickening of veins, serrated edges, chlorosis that turns necrotic and dwarfism to detect the presence of other viruses in mixed infections. We worked with 20 rice plants sampled in the San Javier area (Santa Fe, Argentina) and that were positive for RSNV by serology using anti-RSNV antiserum. Total RNA of 5mg leaf tissue from each plant was extracted separately using a Qiagen RNeasy Plant RNA kit. Ten µg of pooled sample was sent for library preparation using Ribo-Zero Plant Kit + TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 1500, 150 nucleotide (nt) flowcell at the IABIMO-CONICET/INTA (Argentina). The 177,005,442 reads generated were mapped to the Oryza sativa genome (RefSeq GCF_001433935) using Geneious software v.9.1.8 (Biomatters Limited, Auckland, New Zealand) to remove rice reads. The remaining reads (63,756,284) were assembled de novo using rnaviralSPAdes, Galaxy tools (https://usegalaxy.org.au/). Contigs were annotated using the BEST HIT of BLASTN vs. nt and BLASTX vs. the non-redundant sequence database. Forty virus sequences were analyzed using the ORF finder and BLAST tools at NCBI (http://www.ncbi.nlm.nih.gov/). The nt identity was calculated using the SDT 1.2 program (Muhire et al., 2014). The BLASTN results showed the presence of 38 contigs (636 reads) with high nt identity (higher than 97.6%) with Mal de Rio Cuarto virus (MRCV), with 58% genome coverage. Two other contigs (120 reads) had high nt identity to Fuyang picorna-like virus 2 (FpiV2, GenBank access MT317172), with 38% genome coverage. MRCV is a species of the Fijivirus genus, Reoviridae family, with a linear dsRNA genome composed of 10 segments encoding 12 proteins (Matthijnssens et al., 2022). In this work, it was possible to partially sequence the 10 segments of MRCV. Contigs with lengths greater than 1,000nt were detected that correspond to segments S1 (2029nt), S2 (2308nt), S3 (1249nt) and S4 (1067nt) and showed 98.32%, 98.48%, 97.68% and 97.75% nt identity with the reference sequences (GenBank access NC_008733, NC_008730, NC_008732 and NC_008729), respectively. A contig of 400 nt was identified as a capsid protein (CP) gene fragment (S10) with 98.75% nt identity to the reference sequence (NC_008734). The presence of MRCV was confirmed in 3 of the 20 samples by DAS-ELISA serological test using anti-MRCV antiserum. FpiV2 was reported for the first time infecting rice in China and, due to its genomic structure, was proposed as a new member of the Picornaviridae family, but without an assigned genus (Chao et al., 2021). It is a monopartite virus, with a linear ssRNA(+) genome of 9.2kb. Analysis of two sequence fragments (1587nt and 2086nt) revealed that they corresponded to the putative RdRp with 83.9% nt identity (90.2% aa) and the putative CP sequence with 86.7% nt identity (96.3% aa) with the GenBank sequence MT317172, respectively. Detection of this picorna-like virus was further confirmed in 2 of the 20 samples by RT-PCR and Sanger sequencing with virus-specific primers (PL2Fw: 5' TTATTTGTGAGTAACAGCCCAGCAC 3'; PL2Rv: 5' AGACCGAGGACTATGGAAGCCTTTC 3', 540nt). To our knowledge, this is the first report of rice as a natural host of MRCV and may be the second detection of FpiV2 worldwide.

RESUMO

Resumen En este estudio se evaluó la actividad antimicrobiana in vitro de extractos de Xenophyllum poposum sobre microorganismos bucales como Streptococcus mutans, Streptococcus sobrinus, Lactobacillus casei, Actinomyces naeslundii, Actinomyces odontolyticus, Candida albicans y Veillonella sp. Se empleó el método de difusión radial en agar y como controles negativo y positivo de inhibición se emplearon etanol y clorhexidina al 0,12% (Plac out NF®) respectivamente. Los extractos con mayor actividad antimicrobiana fueron el etanólico y el clorofórmico. La diferencia entre ambos no fue estadísticamente significativa (p≥0,05). Tampoco se observó diferencia significativa con respecto a la clorhexidina, excepto sobre Veillonella sp., ya que el extracto etanólico presentó halos de inhibición significativamente menores sobre este microorganismo. Esto es importante ya que Veillonella se considera indicador de salud en relación a la caries dental. En base a esto, el extracto etanólico de Xenophyllum poposum podría ser usado como control químico de la biopelícula dental.

Abstract In this study, the in vitro antimicrobial activity of Xenophyllum poposum extracts on oral microorganisms such as Streptococcus mutans, Streptococcus sobrinus, Lactobacillus casei, Actinomyces naeslundii, Actinomyces odontolyticus, Candida albicans, Veillonella sp. was evaluated. The radial diffusion method in agar was used and 0.12% ethanol and chlorhexidine (Plac out NF®) were used as negative and positive inhibition controls, respectively. The extracts with the highest antimicrobial activity were the ethanolic and chloroform extracts. The difference between the two was not statistically significant (p≥0.05). No significant difference was observed with respect to chlorhexidine, except on Veillonella sp., since the ethanolic extract presented significantly lower inhibition halos on this microorganism. This is important as Veillonella is considered an indicator of health in relation to dental caries. Based on this, the ethanolic extract of Xenophyllum poposum could be used as chemical control of dental biofilm.

Resumo Neste estudo, a atividade antimicrobiana de extratos de Xenophyllum poposum sobre microrganismos orais como Streptococcus mutans, Streptococcus sobrinus, Lactobacillus casei, Actinomyces naeslundii, Actinomyces odontolyticus, Candida albicans e Veillonella sp. Foi utilizado o método de difusão radial em ágar e etanol 0,12% e clorexidina (Plac out NF®) como controles de inibição negativa e positiva, respectivamente. Os extratos com maior atividade antimicrobiana foram os extratos etanólico e clorofórmio. A diferença entre os dois não foi estatisticamente significativa (p≥0,05). Não foi observada diferença significativa em relação à clorexidina 0,12%, exceto em Veillonella sp., uma vez que o extrato etanólico apresentou halos de inibição significativamente menores neste microrganismo. Isso é importante, pois a Veillonella é considerada um indicador de saúde em relação à cárie dentária. Com base nisso, o extrato etanólico de Xenophyllum poposum pode ser utilizado como controle químico do biofilme dental.

Assuntos

RESUMO

RESUMEN Introducción: Durante enfermedades infecciosas emergentes en curso como la COVID-19, la vigilancia espacio-temporal es fundamental para identificar áreas prioritarias para intervenciones específicas, diferenciar intensidad diagnóstica y asignación de recursos. Objetivo: Modelar la evolución del riesgo relativo de presentación de casos de COVID-19 e identificar conglomerados en municipios donde la enfermedad se mantuvo en el periodo posterior al descenso de la curva epidémica en Cuba. Métodos: El periodo mencionado comprendió entre el 26/05/2020 hasta el 4/09/2020. Se realizaron corridas cíclicas del modelo prospectivo espacio-temporal de Poisson, con incrementos progresivos de 14 días, mediante la aplicación SaTScan™ 9.6. Resultados: Se identificaron 15 conglomerados significativos (p ≤ 0,0001) cuya extensión involucró desde uno hasta trece municipios, con distribución en seis provincias (Pinar del Río, Artemisa, La Habana, Mayabeque, Matanzas, Villa Clara y Ciego de Ávila). En los conglomerados todos los municipios mostraron riesgo relativo alto, entre ellos, La Palma en la provincia de Pinar del Río y Ciego de Ávila en la provincia del mismo nombre, con los valores más altos, 119,95 y 121,04, respectivamente. Conclusión: El modelo empleado pudo identificar los conglomerados en territorios con significativa probabilidad de ocurrencia de COVID-19, así como periodos de evolución del riesgo relativo. Además, reconoce los municipios que merecen prioridad para intensificar en ellos intervenciones de contención y control sanitario y evitar la reemergencia de la enfermedad con mayor dispersión espacial.

ABSTRACT Introduction: During the occurrence of ongoing emerging infectious diseases such as COVID-19, spatiotemporal surveillance is crucial to identify priority areas for specific interventions, differentiate diagnostic intensity and assign resources. Objective: To model the evolution of the relative risk of presentation of COVID-19 cases and to identify clusters in municipalities where the disease remains at the stage following the descent of the epidemic curve in Cuba. Methods: The period mentioned was from 26/05/2020 to 4/09/2020. Cyclic runs of Poisson's prospective spatiotemporal model were performed, with progressive 14-day increases, using the software SaTScan™ 9.6. Results: A total 15 significant clusters were identified (p ≤ 0.0001) extending over one to thirteen municipalities and distributed in six provinces (Pinar del Río, Artemisa, Havana, Mayabeque, Matanzas, Villa Clara and Ciego de Ávila). In the clusters, all municipalities showed a high relative risk among them, La Palma in Pinar del Rio province and Ciego de Avila in the province of the same name, with the highest values, 119.95 and 121.04, respectively. Conclusion: The model was able to identify territories with a significant likelihood of COVID-19 occurrence, as well as periods in the evolution of relative risk. It also showed that surveillance and early warning strategies may facilitate prioritization of health control and containment interventions aimed at preventing the reemergence of the disease with greater spatial coverage.

RESUMO

Introducción: El personal de la salud tiene mayor probabilidad de contraer la infección con Mycobacterium tuberculosis por su exposición incrementada a pacientes con la enfermedad. Objetivo: Evaluar el nivel de conocimientos sobre las medidas para el control y prevención de la tuberculosis en el personal de enfermería y los posibles factores que pudieran incidir en este. Métodos: Diseño mixto con triangulación de datos, utilizando técnicas cuanti-cualitativas. Se aplicó un cuestionario autoadministrado-semiestructurado a 64 enfermeros del Instituto Pedro Kourí durante el 2017. Los conocimientos se evaluaron como bien, aceptables y deficientes. Se calcularon las proporciones de calificaciones por categoría. Se realizó análisis univariado para buscar posible asociación del nivel de conocimientos con las covariables (sexo, edad, nivel profesional, servicio, años de experiencia laboral y en el instituto, antecedentes de atención a pacientes con tuberculosis y capacitación recibida). Para las salidas cualitativas, las observaciones fueron procesadas mediante la técnica de análisis de contenido. Resultados: Los conocimientos en general fueron evaluados como deficientes en 75,4 por ciento y nadie alcanzó bien. La mejor calificación fue sobre recogida de muestras (86,2 por ciento). El resto fueron mayormente aceptables o deficientes. El tema con mayores deficiencias fue métodos de prevención. El 56,9 por ciento percibe estar en riesgo. Ser técnico de enfermería resultó asociado con deficientes resultados de la evaluación de conocimientos sobre tuberculosis. Conclusiones: Los conocimientos sobre medidas de control de infección tuberculosa se consideraron deficientes. La percepción del riesgo varía según la valoración sobre las medidas de control existentes. Los conocimientos deficientes se asociaron fundamentalmente a la categoría de técnico(AU)

Introduction: Health personnel are more likely to get infected by Mycobacterium tuberculosis because of the increased exposure to patients with the disease. Objectives: To evaluate the level of knowledge about the measures of control and prevention of tuberculosis in nursing staff and the possible factors that could influence. Methods: Mixed design with triangulation of data, using quantitative and qualitative techniques. A self-administered semi-structured questionnaire was applied to 64 nurses from Pedro Kourí Institute during 2017. Knowledge was graded good, acceptable and poor. Grade ratios were calculated by category. Univariate analysis was performed to look for possible association of the level of knowledge with the covariates (sex, age, professional level, service, years of work experience, years of work in the institute, history of care for patients with tuberculosis and training). For qualitative outputs, observations were processed using the content analysis technique. Results: Knowledge in general was graded poor in 75.4 percent and nobody was graded as good. The best grade was on sample collection (86.2 percent). The rest were mostly acceptable or poor. Prevention methods had the greatest deficiencies. 56.9 percent perceived being at risk. The category of nursing technician was associated with poor results of the assessment of tuberculosis knowledge. Conclusions: Knowledge about tuberculosis infection control measures were considered poor. The perception of risk varies according to the assessment of existing control measures. Poor knowledge was fundamentally associated with the category of technician(AU)

Assuntos

RESUMO

Resumen: Son múltiples las formas de interpretar una gasometría, aunque ninguna mejor que la otra. Una correcta interpretación de la gasometría es una habilidad que todo médico debe dominar. Intentar interpretar «todo a la vez¼ y de forma poco organizada es el error más común. Entonces el secreto para desarrollar dicha habilidad radica en el «orden¼, por lo que te sugerimos utilizar sólo 3 pasos, sólo 3 fórmulas. El abordaje diagnóstico de los trastornos ácido-base con el método tradicional de Henderson-Hasselbalch no permite explicar todos los trastornos, pero en combinación con el exceso de base descrito por Siggaard-Andersen, facilita el diagnóstico, además que esta combinación es sencilla, rigurosa y práctica.

Abstract: There are multiple ways of interpreting gasometry, although no better than the other. A correct interpretation of gasometry is a skill that every doctor must dominate. Try to interpret «all at once¼ and little organized is the most common error. Then the secret to developing that skill lies in the «order¼, so we suggest you use only 3 steps, just 3 formulas. The diagnostic approach of acid-base disorders with the method. Traditional of Henderson-Hasselbalch does not allow to explain all disorders, but in combination with the excess of base described by Siggaard-Andersen, facilitates the diagnosis, besides that this combination is simple, rigorous and practical.

Resumo: Há muitas maneiras de interpretar uma gasometria, embora nenhuma melhor que a outra. Uma interpretação correta da gasometria é uma habilidade que todo médico deve dominar. Tentar interpretar «tudo de uma vez¼ e de maneira mal organizada é o erro mais comum. Então o segredo para desenvolver essa habilidade está na «ordem¼, por isso sugerimos que você use apenas 3 passos, somente 3 fórmulas. A abordagem diagnóstica de distúrbios ácido-base com o método tradicional de Henderson-Hasselbalch não explica todas as desordens, mas em combinação com o excesso de base descrito por Siggaard-Andersen, facilita o diagnóstico, além de que esta combinação é simples, rigorosa e prática.

RESUMO

[RESUMEN]. En el presente artículo se identifican rasgos distintivos y esenciales en las transformaciones del sistema de salud cubano que han permitido la erradicación y disminución de las tasas de incidencia de algunas enfermedades transmisibles a niveles inferiores a 0,1 por 100 000 habitantes. Los resultados obtenidos son consecuencia de la importancia otorgada a la prevención y control de estas enfermedades, así como a los riesgos y daños potenciales. La estructura y funcionamiento del subsistema de higiene y epidemiología y sus interrelaciones con el resto del sistema a partir de los diferentes modelos de prestación de servicios han constituido escenarios de integración permanentes para la toma de decisiones. Se eliminaron enfermedades como la poliomielitis, paludismo, difteria, tosferina, rubéola, parotiditis, meningitis posparotiditis, sarampión, fiebre amarilla, cólera, formas graves de la tuberculosis, rabia humana transmitida por caninos, leishmaniasis, enfermedad de Chagas, la transmisión vertical del virus de inmunodeficiencia humana, sífilis congénita y formas clínicas como el tétanos neonatal y el síndrome de rubéola congénita. Se hace énfasis en algunas enfermedades transmisibles y, en especial, en la respuesta social desarrollada contra la tuberculosis, la lepra, el sida y las enfermedades transmitidas por vectores. Se demuestra que el contexto sanitario actual revela aún desafíos para la sostenibilidad de los logros alcanzados en el país. Garantizar el mantenimiento de la cobertura universal con acceso de la población cubana a los servicios de salud será siempre un principio de la salud pública cubana.

[ABSTRACT]. This article presents distinctive and essential features in the transformations of the Cuban health system that have allowed the eradication and reduction of the incidence rates of some communicable diseases at levels lower than 0.1 per 100 000 inhabitants. The results obtained are a consequence of the importance given to the prevention and control, as well as to the risks and potential damages, of these diseases. The structure and functioning of the hygiene and epidemiology subsystem and its interrelations with the rest of the system, based on the different models of service provision, have been permanent integration scenarios for decision making. Diseases such as poliomyelitis, malaria, diphtheria, whooping cough, rubella, mumps, post-mumps meningitis, measles, yellow fever, cholera, severe forms of tuberculosis, human rabies transmitted by canines, leishmaniasis, Chagas disease, vertical transmission of HIV, congenital syphilis and clinical forms such as neonatal tetanus and congenital rubella syndrome were eliminated. Some communicable diseases are analyzed in more detail and, in particular, the social response developed against tuberculosis, leprosy, AIDS and vector-borne diseases. However, the current health context presents challenges for the sustainability of the achievements made in the country. Assuring the maintenance of universal coverage with access of the Cuban population to health services will always be a principle of Cuban public health.

[RESUMO]. No presente artigo se identificam características específicas e essenciais nas transformações do sistema de saúde cubano que permitiram a erradicação e redução das taxas de incidência de algumas doenças transmissíveis a níveis inferiores a 0,1 por 100 000 habitantes. Os resultados obtidos são uma conseqüência da importância dada à prevenção e controle dessas doenças, bem como aos riscos e danos potenciais. A estrutura e o funcionamento do subsistema de higiene e epidemiologia e suas inter-relações com o resto do sistema, com base nos diferentes modelos de prestação de serviços, constituíram cenários de integração permanente para a tomada de decisões. Foram eliminadas doenças como a poliomielite, malária, difteria, coqueluche, rubéola, parotidite, meningite pós-parotidite, sarampo, febre amarela, cólera, formas graves de tuberculose, raiva humana transmitida por cães, leishmaniose, doença de Chagas, a transmissão vertical do vírus da imunodeficiência humana, sífilis congênita e formas clínicas como o tétano neonatal e a síndrome da rubéola congênita. É dada ênfase a algumas doenças transmissíveis e, em particular, à resposta social desenvolvida contra a tuberculose, a hanseniasis, a AIDS e as doenças transmitidas por vetores. Mostra-se que o atual contexto de saúde revela desafios para a sustentabilidade das realizações no país. Garantir a manutenção da cobertura universal com acesso da população cubana aos serviços de saúde sempre será um princípio da saúde pública cubana.

Assuntos

RESUMO

Resumen: Introducción: El uso de corticosteroides para el tratamiento de pacientes con choque séptico ha llevado a considerar su empleo en otros procesos patológicos, entre ellos, el choque hipovolémico hemorrágico, aunque con resultados controversiales. Material y métodos: Se realizó un estudio de cohorte, prospectivo, longitudinal, observacional y analítico. Se incluyeron pacientes ingresados a la Unidad de Cuidados Intensivos (UCI) con diagnóstico de choque hipovolémico hemorrágico secundario a evento quirúrgico en el periodo comprendido entre el 1 de enero y el 31 de julio de 2017. Resultados: Por medio de la curva ROC se estableció el punto de corte para el cortisol sérico al ingreso a la UCI, estimado en 39.1 µg/dL, con área bajo la curva de 1.00 (IC95% 0.0012-0.2487, p = 0.0001). La sensibilidad fue de 100%, con especificidad de 100%; los coeficientes de probabilidad positivo y negativo fueron de 14 y cero, respectivamente. Conclusión: Los niveles de cortisol sérico medidos al ingreso a la UCI superiores a 39.1 µg/dL se asocian con mayor mortalidad en los pacientes postquirúrgicos con choque hipovolémico hemorrágico.

Abstract: Introduction: The use of corticosteroids for the treatment of patients with septic shock has led to consider their use in other pathological processes, including hypovolemic hemorrhagic shock, although with controversial results. Material and methods: A prospective, longitudinal, observational and analytical cohort study was conducted. We included patients admitted to the intensive care unit (ICU) with a diagnosis of hypovolemic hemorrhagic shock secondary to a surgical event in the period from January 1 to July 31 of 2017. Results: The cutoff point for serum cortisol at ICU admission was established using the ROC curve, estimated at 39.1 µg/dL, with an area under the curve of 1.00 (95%CI 0.0012-0.2487, p = 0.0001). Sensitivity was 100%, with a specificity of 100%. The positive and negative probability coefficients were 14 and zero, respectively. Conclusion: Serum cortisol levels measured at admission to the ICU greater than 39.1 µg/dL are associated with higher mortality in post-surgical patients with hypovolemic hemorrhagic shock.

Resumo: Introdução: O uso de corticosteróides para o tratamento de pacientes com choque séptico levou a considerar a sua utilização em outros processos patológicos, entre eles o choque hipovolêmico hemorrágico, embora com resultados controversos. Material e métodos: Realizou-se um estudo de coorte, prospectivo, longitudinal, observacional e analítico. Incluímos os pacientes admitidos na unidade de terapia intensiva (UTI) com diagnóstico de choque hipovolêmico hemorrágico secundário a um evento cirúrgico no período de 1 de janeiro a 31 de julho de 2017. Resultados: Através da curva ROC foi estabelecido o ponto de corte para o cortisol sérico na admissão na UTI, estimado em 39.1 µg/dL com área sob a curva de 1.00 (IC 95% 0.0012-0.2487, p = 0.0001). A sensibilidade foi de 100% com uma especificidade de 100%; os coeficientes de probabilidade positivo e negativo foram 14 e 0, respectivamente. Conclusão: Os níveis de cortisol séricos medidos na admissão na UTI superiores a 39.1 µg/dL estão associados com aumento da mortalidade em pacientes pós cirúrgicos com choque hipovolêmico hemorrágico.