RESUMO

The diagnosis of umbilical infections in neonates can be obtained from clinical signs, but the intracavitary involvement of structures and associated complications can be underestimated, compromising the establishment of adequate therapeutic approaches or prognosis. This case report presents the clinical, imaging, pathological and microbiological aspects of an umbilical infection in calves. Physical examination of the animal identified apathy, low body score, increased volume in the umbilical region and joints. The abdominal palpation identified firm structures in topography of the arteries and umbilical vein. Imaging examinations of the abdomen and joints were performed. Multiple, hyperechogenic focal structures have been identified in the liver, as well as cylindrical and firm structures in topography of the arteries and umbilical vein. In the joints, osteolytic changes, periosteal reactions, subchondral sclerosis and formation of osteophytes were seen. Umbilical panvasculitis triggered arthritis and an infectious process in the liver, the case being assessed as having an unfavorable prognosis and the animal being referred for euthanasia. At necropsy, multifocal abscesses were observed in the pleura, ribs, omentum, spleen and liver. There was granulomatous exudate in the urinary vesicle. The affected joints presented thickening of the joint capsule with the presence of exudat

O diagnóstico das infecções umbilicais em neonatos pode ser obtido a partir do exame clínico, porém o compro-metimento intracavitário das estruturas e as complicações associadas podem ser subestimados, comprometendo o estabeleci-mento de condutas terapêuticas ou prognósticos adequados. Apresenta-se nesse trabalho os aspectos clínicos, imaginológicos e patológicos de uma infecção umbilical em bezerro. No exame físico do animal identificou-se apatia, baixo escore corporal, aumento de volume na região umbilical e articulações e, em palpação abdominal, estruturas firmes em topografia das artérias e veia umbilical. Na avaliação ultrassonográfica abdominal identificou-se estruturas focais múltiplas, hiperecogênicas no fígado e estrutura bem definida, com parede hipoecoica e lúmen hiperecoico, estendendo-se de lobo hepático até porção cranial do anel umbilical. Na radiografia das articulações foram vistas alterações osteolíticas, reação periosteal, esclerose e formação de osteófitos, além do aumento de volume e radiopacidade de tecido moles adjacentes com presença de áreas radiolucentes, indi-cando presença gasosa local. Os sinais clínicos e os achados imaginológicos demonstraram a ocorrência de panvasculite umbi-lical que desencadeou um quadro de poliartrite séptica e processos infecciosos em diversos órgãos. O estudo imaginológico permitiu identificar onfaloflebite, grave acometimento de parênquima hepático e artrites sépticas, sendo o caso avaliado como tendo um prognóstico desfavorável e o animal eutanasiado. O tratamento conservador com antibioticoterapia prolongada e/ou a retirada ou marsupialização dos remanescentes umbilicais infectados podem ser utilizados em casos de onfaloflebites ou onfaloarterites. No entanto, esse procedimento não foi adotado devido ao comprometimento hepático e aos achados radio-gráficos que demonstraram ocorrência de osteoartrite séptica.

Assuntos

RESUMO

The diagnosis of umbilical infections in neonates can be obtained from clinical signs, but the intracavitary involvement of structures and associated complications can be underestimated, compromising the establishment of adequate therapeutic approaches or prognosis. This case report presents the clinical, imaging, pathological and microbiological aspects of an umbilical infection in calves. Physical examination of the animal identified apathy, low body score, increased volume in the umbilical region and joints. The abdominal palpation identified firm structures in topography of the arteries and umbilical vein. Imaging examinations of the abdomen and joints were performed. Multiple, hyperechogenic focal structures have been identified in the liver, as well as cylindrical and firm structures in topography of the arteries and umbilical vein. In the joints, osteolytic changes, periosteal reactions, subchondral sclerosis and formation of osteophytes were seen. Umbilical panvasculitis triggered arthritis and an infectious process in the liver, the case being assessed as having an unfavorable prognosis and the animal being referred for euthanasia. At necropsy, multifocal abscesses were observed in the pleura, ribs, omentum, spleen and liver. There was granulomatous exudate in the urinary vesicle. The affected joints presented thickening of the joint capsule with the presence of exudat(AU)

O diagnóstico das infecções umbilicais em neonatos pode ser obtido a partir do exame clínico, porém o compro-metimento intracavitário das estruturas e as complicações associadas podem ser subestimados, comprometendo o estabeleci-mento de condutas terapêuticas ou prognósticos adequados. Apresenta-se nesse trabalho os aspectos clínicos, imaginológicos e patológicos de uma infecção umbilical em bezerro. No exame físico do animal identificou-se apatia, baixo escore corporal, aumento de volume na região umbilical e articulações e, em palpação abdominal, estruturas firmes em topografia das artérias e veia umbilical. Na avaliação ultrassonográfica abdominal identificou-se estruturas focais múltiplas, hiperecogênicas no fígado e estrutura bem definida, com parede hipoecoica e lúmen hiperecoico, estendendo-se de lobo hepático até porção cranial do anel umbilical. Na radiografia das articulações foram vistas alterações osteolíticas, reação periosteal, esclerose e formação de osteófitos, além do aumento de volume e radiopacidade de tecido moles adjacentes com presença de áreas radiolucentes, indi-cando presença gasosa local. Os sinais clínicos e os achados imaginológicos demonstraram a ocorrência de panvasculite umbi-lical que desencadeou um quadro de poliartrite séptica e processos infecciosos em diversos órgãos. O estudo imaginológico permitiu identificar onfaloflebite, grave acometimento de parênquima hepático e artrites sépticas, sendo o caso avaliado como tendo um prognóstico desfavorável e o animal eutanasiado. O tratamento conservador com antibioticoterapia prolongada e/ou a retirada ou marsupialização dos remanescentes umbilicais infectados podem ser utilizados em casos de onfaloflebites ou onfaloarterites. No entanto, esse procedimento não foi adotado devido ao comprometimento hepático e aos achados radio-gráficos que demonstraram ocorrência de osteoartrite séptica.(AU)

Assuntos

RESUMO

The objective of this study was to determine the prevalence of Tritrichomonas foetus infection and to evaluate risk factors associated with this infection among cattle in the state of Paraíba in northeastern Brazil. Samples of cervicovaginal mucus from 290 females and smegma from 59 males [beef, 31; mixed aptitude (beef and dairy), 10; and dairy, 18] from 31 farms were collected. Modified Diamond's medium and polymerase chain reaction (PCR) were used for the laboratory diagnosis of T. foetus infection. Univariate analysis and logistic regression were performed to test for potential risk factors in addition to prevalence mapping. No sample was positive for T. foetus in culture, and the prevalence of T. foetus infection using PCR was 3.7% (13/349) [confidence interval (CI) 95%, 2.1%-6.4%]. In total, 19.3% (6/31) of the farms had at least one animal positive for T. foetus. The contact of females with males from other farms [Odds ratio, 5.9; 95% CI, 1.5-22.4; p = 0.009] was identified as a risk factor for T. foetus infection. This study demonstrates that T. foetus infection is prevalent among dairy cows in the state of Paraíba, Brazil. Sexual resting, removal of positive females, and avoiding contact of females with males from other farms are recommended to reduce the risk of infection.

Assuntos

RESUMO

Background: Bovine genital campylobacteriosis (BGC) results in an increase in the interval between calving, increase in age at first calving, increase in the number of doses of semen or services by conception, and reduction in the number of animals born and weaned. Due to the importance of cattle breeding in Brazil, to the impact of BGC on bovine reproductive health, and since campylobacteriosis has never been studied in this region of Brazil, epidemiological studies on C. fetus infection in bovine herds are essential. The objective of this study was to determine prevalence of Campylobacter fetus subsp. venerealis infection in dairy cows from the Brejo Paraibano region, northeastern Brazil.Materials, Methods & Results: A cross-sectional study was conducted to determine prevalence of animals infected by C. fetus subsp. venerealis. In order to compose the sample of the number of farms, a total of 30 farming establishments with milk cattle and expected prevalence of 1.8%, 95% confidence interval (CI) and statistical error of 5% were considered, which provided a minimum of 15 farms. Samples of cervico-vaginal mucus were collected from 273 dairy cows from 19 farms. Polymerase chain reaction was used for laboratory diagnosis using the oligonucleotides VENSF1 (5CTTAGCAGTTTGCGATATTGCCATT3) and VENS2 (5GCTTTTGAGATAACAATAAGAGCTT3) for detection of a 142 base-pairs product. In order to confirm the results, positive samples were purified after amplification and bidirectional sequenced. A thematic map was prepared with prevalence distributions in the studied area. The prevalence of C. fetus subsp. venerealis infection in cows was 7.7% (confidence interval [CI] 95%, 4.8%-11.5%), and 31.6% (6/19) of the farms showed at least one positive animal. Of the six counties surveyed, all (100.0%) had positive animals, with a positive farm per county. Regarding age, it was observed that all positive animals were between two and 15 years old, with a mean age of 6.2 years.[...](AU)

Assuntos

RESUMO

Background: Bovine genital campylobacteriosis (BGC) results in an increase in the interval between calving, increase in age at first calving, increase in the number of doses of semen or services by conception, and reduction in the number of animals born and weaned. Due to the importance of cattle breeding in Brazil, to the impact of BGC on bovine reproductive health, and since campylobacteriosis has never been studied in this region of Brazil, epidemiological studies on C. fetus infection in bovine herds are essential. The objective of this study was to determine prevalence of Campylobacter fetus subsp. venerealis infection in dairy cows from the Brejo Paraibano region, northeastern Brazil.Materials, Methods & Results: A cross-sectional study was conducted to determine prevalence of animals infected by C. fetus subsp. venerealis. In order to compose the sample of the number of farms, a total of 30 farming establishments with milk cattle and expected prevalence of 1.8%, 95% confidence interval (CI) and statistical error of 5% were considered, which provided a minimum of 15 farms. Samples of cervico-vaginal mucus were collected from 273 dairy cows from 19 farms. Polymerase chain reaction was used for laboratory diagnosis using the oligonucleotides VENSF1 (5’CTTAGCAGTTTGCGATATTGCCATT3’) and VENS2 (5’GCTTTTGAGATAACAATAAGAGCTT3’) for detection of a 142 base-pairs product. In order to confirm the results, positive samples were purified after amplification and bidirectional sequenced. A thematic map was prepared with prevalence distributions in the studied area. The prevalence of C. fetus subsp. venerealis infection in cows was 7.7% (confidence interval [CI] 95%, 4.8%-11.5%), and 31.6% (6/19) of the farms showed at least one positive animal. Of the six counties surveyed, all (100.0%) had positive animals, with a positive farm per county. Regarding age, it was observed that all positive animals were between two and 15 years old, with a mean age of 6.2 years.[...]

Assuntos

RESUMO

El objetivo de este estudio fue determinar la prevalencia de la infección por Brucella spp. en équidos en la microrregión del Brejo Paraibano. Doscientos cincuenta y siete muestras fueron analizadas en 26 propiedades. Se utilizó como prueba diagnóstica la técnica rosa de Bengala. Ninguna de las 257 muestras analizadas fue reactiva. Este es el primer estudio que indagó la presencia de anticuerpos contra Brucella spp. en équidos en esta microrregión. A pesar de no haber sido diagnosticados animales reactivos y de la menor relevancia epidemiológica de los équidos en comparación con el ganado bovino, las investigaciones epidemiológicas son necesarias para determinar el status serológico en estas especies, ya que pueden servir como una fuente de infección para otras especies y para el hombre.

The objective of this study was to determine the prevalence of Brucella spp. infection in equids inBrejo Paraibano microregion. Two hundred fifty-seven equids serum samples of 26 propertieswere analyzed. For diagnosis, Rose Bengal Test (RBT) was performed. Among the 257 samplesanalyzed there was no serum reagent. This is the first study that researched Brucella spp.antibodies in equids in this microregion. Even with no reagent samples and the lowerepidemiological importance of infection in equids, compared with cattle herds, epidemiologicalinvestigations are needed to determine the serological status in these species, since they can serveas a source of infection for other species, including man.

Objetivou-se com este estudo determinar a prevalência da infecção por Brucella spp. em equídeos no Brejo Paraibano. Foram analisadas 257 amostras em 26 propriedades. Para o diagnóstico utilizou-se o teste do Antígeno Acidificado Tamponado. Das 257 amostras analisadas nenhuma foi reagente. Este é o primeiro estudo a pesquisar anticorpos contra Brucella spp. em equídeos nessa microrregião. Apesar de não terem sido diagnosticados animais reagentes e da menor importância epidemiológica em equídeos se comparados aos bovídeos, inquéritos epidemiológicos são necessários para determinar o status sorológico nestas espécies, uma vez que as mesmas podem servir como fonte de infecção para outras espécies, incluindo o homem.

RESUMO

A brucelose é uma doença infecto-contagiosa provocada por bactérias do gênero Brucella. Brucella abortus é a espécie responsável pela maioria das infecções em bovinos e bubalinos, nos quais, está associado principalmente com problemas reprodutivos, o que gera grandes prejuízos econômicos. Além disto, pelo fato de possuir caráter zoonótico, gera também preocupações no âmbito da saúde pública. Desconhecem-se a prevalência real e a distribuição desta enfermidade nos rebanhos do Rio Grande do Norte, informações relevantes para que se possam adotar as devidas medidas de controle e prevenção. Objetivou-se no presente trabalho determinar a frequência e a distribuição da brucelose em bovídeos no Estado do Rio Grande do Norte, nos anos de 2008 e 2009. Foram utilizados os informes mensais sobre a ocorrência e o diagnóstico de brucelose, enviados pelas Unidades Locais de Saúde Animal e Vegetal para a sede do Instituto de Defesa e Inspeção Agropecuária do Rio Grande do Norte. As frequências de focos e de animais infectados no Estado, no ano de 2008, foram de 3,99% e 1,86%, respectivamente. No ano de 2009 essas frequências foram de 3,47% e 2,62%, respectivamente, demonstran- do que a brucelose está presente e com frequências variadas na maior parte das regiões do Rio Grande do Norte.(AU)

Brucellosis is an infectious disease caused by the bacteria Brucella sp.. Brucella abortus is the species responsible for most of the infections in cattle and buffaloes, which is mainly associated with reproductive disturbances, which causes great economic losses. Moreover, as a zoonosis, it is also a public health concern. The prevalence and distribution of this disease in flocks of Rio Grande do Norte are unknown. This information is relevant to control and prevent disease in the State. The aim of this study was verify the frequency and distribution of brucellosis in cattle from Rio Grande do Norte between 2008 and 2009. We adopted the database of the occurrence and diagnosis of brucellosis employed by the Local Units for Animal and Plant Health, which were reported to the headquarters of the Institute for Agropecuary Defense and Inspection of Rio Grande do Norte. The frequency of outbreaks and infected animals in the state were 3.99% and 1.86%, respectively in 2008, and 3.47% and 2.62%, respectively in 2009. The study showed that brucellosis is present and with variable frequency in most regions of Rio Grande do Norte.(AU)

Assuntos