RESUMO
Targeted massively parallel sequencing (TMPS) has been used in genetic diagnosis for Mendelian disorders. In the past few years, the TMPS has identified new and already described genes associated with primary ovarian insufficiency (POI) phenotype. Here, we performed a targeted gene sequencing to find a genetic diagnosis in idiopathic cases of Brazilian POI cohort. A custom SureSelectXT DNA target enrichment panel was designed and the sequencing was performed on Illumina NextSeq sequencer. We identified 1 homozygous 1-bp deletion variant (c.783delC) in the GDF9 gene in 1 patient with POI. The variant was confirmed and segregated using Sanger sequencing. The c.783delC GDF9 variant changed an amino acid creating a premature termination codon (p.Ser262Hisfs*2). This variant was not present in all public databases (ExAC/gnomAD, NHLBI/EVS and 1000Genomes). Moreover, it was absent in 400 alleles from fertile Brazilian women screened by Sanger sequencing. The patient's mother and her unaffected sister carried the c.783delC variant in a heterozygous state, as expected for an autosomal recessive inheritance. Here, the TMPS identified the first homozygous 1-bp deletion variant in GDF9. This finding reveals a novel inheritance pattern of pathogenic variant in GDF9 associated with POI, thus improving the genetic diagnosis of this disorder.
Assuntos
Fator 9 de Diferenciação de Crescimento/genética , Sequenciamento de Nucleotídeos em Larga Escala , Insuficiência Ovariana Primária/genética , Adulto , Alelos , Brasil , Códon sem Sentido/genética , Feminino , Homozigoto , Humanos , Mutação , Linhagem , Insuficiência Ovariana Primária/fisiopatologia , Deleção de Sequência/genética , Adulto JovemRESUMO
Type 1 insulin-like growth factor receptor (IGF-1R) is overexpressed in a variety of human cancers, including adrenocortical tumors. The aim of the work was to investigate the effects of IGF-1R downregulation in a human adrenocortical cell line by small interfering RNA (siRNA). The human adrenocortical tumor cell line NCI H295R was transfected with 2 specific IGF1R siRNAs (# 1 and # 2) and compared with untreated cells and a negative control siRNA. IGF1R expression was determined by quantitative reverse-transcription PCR (qRTPCR) and Western blot. The effects of IGF-1R downregulation on cell proliferation and apoptosis were assessed. IGF-1R levels were significantly decreased in cells treated with IGF-1R siRNA # 1 or # 2. Relative expression of IGF1R mRNA decreased approximately 50% and Western blot analysis revealed a 30% of reduction in IGF-1R protein. Downregulation of this gene resulted in 40% reduction in cell growth in vitro and 45% increase in apoptosis using siRNA # 2. These findings demonstrate that decreasing IGF-1R mRNA and protein expression in NCI H295R cells can partially inhibit adrenal tumor cell growth in vitro. Targeting IGF1R is a promising therapy for pediatric malignant adrenocortical tumor and can still be an option for adult adrenocortical cancer based on personalized genomic tumor profiling.
Assuntos
Córtex Suprarrenal/citologia , Inativação Gênica , Receptor IGF Tipo 1/metabolismo , Apoptose/genética , Linhagem Celular , Proliferação de Células , Regulação para Baixo/genética , Humanos , RNA Mensageiro/genética , RNA Mensageiro/metabolismo , RNA Interferente Pequeno/metabolismo , Receptor IGF Tipo 1/genéticaRESUMO
OBJECTIVE: PROP1 mutations are the most common cause of genetic combined pituitary hormone deficiency (CPHD). The aim of this study was to investigate the PROP1 gene in two siblings with CPHD. DESIGN: Pituitary function and imaging assessment and molecular analysis of PROP1. PATIENTS: Two siblings, born to consanguineous parents, presented with GH deficiency associated with other pituitary hormone deficiencies (TSH, PRL and gonadotrophins). The male sibling also had an evolving cortisol deficiency. METHODS: Pituitary size was evaluated by magnetic resonance imaging (MRI). PROP1 gene analysis was performed by polymerase chain reaction (PCR), automatic sequencing and Southern blotting. Amplification of sequence tag sites (STS) and the Q8N6H0 gene flanking PROP1 were performed to define the extension of PROP1 deletion. RESULTS: MRI revealed a hypoplastic anterior pituitary in the girl at 14 years and pituitary enlargement in the boy at 18 years. The PROP1 gene failed to amplify in both siblings, whereas other genes were amplified. Southern blotting analysis revealed the PROP1 band in the controls and confirmed complete PROP1 deletion in both siblings. The extension of the deletion was 18.4 kb. The region flanking PROP1 contains several Alu core sequences that might have facilitated stem-loop-mediated excision of PROP1. CONCLUSIONS: We report here a complete deletion of PROP1 in two siblings with CPHD phenotype.
Assuntos
Nanismo Hipofisário/genética , Proteínas de Homeodomínio/genética , Hipopituitarismo/genética , Adolescente , Southern Blotting , Consanguinidade , Nanismo Hipofisário/patologia , Feminino , Deleção de Genes , Homozigoto , Humanos , Hipopituitarismo/patologia , Masculino , Adeno-Hipófise/patologia , IrmãosRESUMO
In most mammals, male development is triggered by the transient expression of the SRY gene, which initiates a cascade of gene interactions ultimately leading to the formation of a testis from the indifferent fetal gonad. Mutation studies have identified several genes essential for early gonadal development. We report here a molecular study of the SRY, DAX1, SF1 and WNT4 genes, mainly involved in sexual determination, in Brazilian 46,XX and 46,XY sex-reversed patients. The group of 46,XX sex-reversed patients consisted of thirteen 46,XX true hermaphrodites and four 46,XX males, and was examined for the presence of the SRY gene and for the loss of function (inactivating mutations and deletions) of DAX1 and WNT4 genes. In the second group consisting of thirty-three 46,XY sex-reversed patients we investigated the presence of inactivating mutations in the SRY and SF1 genes as well as the overexpression (duplication) of the DAX1 and WNT4 genes. The SRY gene was present in two 46,XX male patients and in none of the true hermaphrodites. Only one mutation, located outside homeobox domain of the 5' region of the HMG box of SRY (S18N), was identified in a patient with 46,XY sex reversal. A novel 8-bp microdeletion of the SF1 gene was identified in a 46,XY sex-reversed patient without adrenal insufficiency. The dosage of DAX1 and WNT4 was normal in the sex-reversed patients studied. We conclude that these genes are rarely involved in the etiology of male gonadal development in sex-reversed patients, a fact suggesting the presence of other genes in the sex determination cascade
Assuntos
Humanos , Masculino , Transtornos do Desenvolvimento Sexual , Disgenesia Gonadal , Mutação , Processos de Determinação SexualRESUMO
In most mammals, male development is triggered by the transient expression of the SRY gene, which initiates a cascade of gene interactions ultimately leading to the formation of a testis from the indifferent fetal gonad. Mutation studies have identified several genes essential for early gonadal development. We report here a molecular study of the SRY, DAX1, SF1 and WNT4 genes, mainly involved in sexual determination, in Brazilian 46,XX and 46,XY sex-reversed patients. The group of 46,XX sex-reversed patients consisted of thirteen 46,XX true hermaphrodites and four 46,XX males, and was examined for the presence of the SRY gene and for the loss of function (inactivating mutations and deletions) of DAX1 and WNT4 genes. In the second group consisting of thirty-three 46,XY sex-reversed patients we investigated the presence of inactivating mutations in the SRY and SF1 genes as well as the overexpression (duplication) of the DAX1 and WNT4 genes. The SRY gene was present in two 46,XX male patients and in none of the true hermaphrodites. Only one mutation, located outside homeobox domain of the 5' region of the HMG box of SRY (S18N), was identified in a patient with 46,XY sex reversal. A novel 8-bp microdeletion of the SF1 gene was identified in a 46,XY sex-reversed patient without adrenal insufficiency. The dosage of DAX1 and WNT4 was normal in the sex-reversed patients studied. We conclude that these genes are rarely involved in the etiology of male gonadal development in sex-reversed patients, a fact suggesting the presence of other genes in the sex determination cascade.
Assuntos
Transtornos do Desenvolvimento Sexual/genética , Disgenesia Gonadal/genética , Mutação/genética , Processos de Determinação Sexual , Receptor Nuclear Órfão DAX-1 , Proteínas de Ligação a DNA/genética , Genes sry/genética , Humanos , Masculino , Proteínas Proto-Oncogênicas/genética , Receptores do Ácido Retinoico/genética , Proteínas Repressoras/genética , Proteínas Wnt , Proteína Wnt4RESUMO
BACKGROUND: The importance of the Y chromosome in male determination has been well established for a long time. The presence of a translocation of chromosomal material encoding the Testis-Determining Factor from Y to another chromosome has been one of the hypothesis to explain testicular development in XX sex-reversed patients. MATERIAL AND METHODS: In the present study, we searched for SRY sequence in genomic DNA isolated from peripheral leukocytes in eleven 46,XX true hermaphrodites and four 46,XX males (only one with ambiguous genitalia). We also analyzed the presence of SRY sequence in fresh gonadal tissues from two 46,XX true hermaphrodites. RESULTS: SRY sequence was absent in DNA blood samples of all true hermaphrodites and in testicular and ovarian tissues of two cases studied. Of the four 46,XX males, two with normal male external genitalia were SRY positive. CONCLUSIONS: We did not identify the SRY gene in 46,XX true hermaphrodites and 46,XX males with ambiguous genitalia, therefore SRY translocation to X chromosome or autosome is unlikely. Hidden Y mosaicism in gonadal tissues was also ruled out in two cases, suggesting that cryptic SRY mosaicism in gonadal tissues is not the usual mechanism responsible for testicular development in patients with 46,XX true hermaphroditism. However, SRY gene was identified in two 46,XX males with male external genitalia showing that SRY gene determined their male phenotype. Despite the recent advances in the knowledge of the role of several genes involved in sexual determination we are still unable to explain the cause of most of Y-chromosome-negative 46,XX sex-reversed patients.
Assuntos
Proteínas de Ligação a DNA/genética , Proteínas Nucleares , Fatores de Transcrição , Transexualidade , Feminino , Humanos , Cariotipagem , Proteína da Região Y Determinante do SexoRESUMO
Genome analysis was carried out on adenovirus strains isolated from patients with acute follicular conjunctivitis in the city of São Paulo, Brazil. Eighteen conjunctival scrapings, collected between December 1993 and March 1994, were analyzed by two methods: a combination of polymerase chain reaction with restriction fragment length polymorphism and viral DNA restriction analysis, carried out using 10 restriction endonucleases: BamHI, BglI, BglII, HindIII, KpnI, SacI, SalI, SmaI, XbaI, and XhoI. Among 11 adenovirus detected by cell culture isolation, nine were Ad8, and two were Ad7. By restriction analysis the Ad8 isolates were typed as two new variants-Ad8/D11 (seven of nine samples) and Ad8/D12 (two of nine samples). Ad7 isolates were identified as a subtype of the widespread genome type Ad7b and the virulent type Ad7h, a predominant genome type circulating in Argentina, Chile, and Uruguay but absent in Brazil until 1991.
Assuntos
Infecções por Adenoviridae/virologia , Adenoviridae/genética , Conjuntivite Viral/virologia , Doença Aguda , Adenoviridae/classificação , Adenoviridae/isolamento & purificação , Adulto , Brasil , DNA Viral/análise , Feminino , Genótipo , Humanos , Masculino , Reação em Cadeia da Polimerase , Polimorfismo de Fragmento de RestriçãoRESUMO
A previous screening of 17 mutations in 130 Brazilian patients with congenital adrenal hyperplasia due to 21-hydroxylase deficiency did not identify mutations in 20% of the alleles. To diagnose these alleles we sequenced the entire CYP21 gene of one Mulatto patient with the simple virilizing form, who had only the R356W mutation in a heterozygous state. We identified a heterozygous G-A transition in codon 424. This mutation leads to a substitution of glycine by serine in a conserved region where glycine is conserved in at least 4 species. This novel mutation eliminates 1 of the restriction sites of the BanI enzyme, which made its screening possible for the whole series. The G424S mutation was found in a compound heterozygous state in 5 families; 4 presented the simple virilizing form, and 1 presented the nonclassical form. Interestingly, 3 of 5 families have a Mulatto origin. This mutation was not identified in 118 CYP21 alleles of normal individuals, ruling out the possibility of a polymorphism, or in 80 pseudogenes, indicating a casual mutagenic event and not a microconversion event. All patients with the G424S mutation presented CYP21P and C4A gene deletions and human leukocyte antigen DR17 on the same haplotype, suggesting a linkage disequilibrium and a probable founder effect. Search for the G424S mutation in other populations will reveal whether it is restricted to the Brazilian patients or if it has a wider ethnic distribution.
Assuntos
Hiperplasia Suprarrenal Congênita/genética , Mutação de Sentido Incorreto , Esteroide 21-Hidroxilase/genética , Feminino , Humanos , Desequilíbrio de Ligação , Masculino , Reação em Cadeia da PolimeraseRESUMO
Determination of fetal sex is essential for prenatal diagnosis of sex-related disorders as congenital adrenal hyperplasia and androgen insensitivity syndrome. Molecular biology has provided the opportunity to analyze genes that identify the presence of Y chromosome through easier and faster methodology than conventional cytogenetics techniques. We used DNA extracted from 8 chorionic villus biopsies, performed at 10-12 weeks of gestation to amplify a 778 bp fragment that corresponds to the coding sequence of the SRY gene to determine fetal sex (primers XES10, XES11). As a internal control of the PCR we also amplified in the same reaction a 650 bp fragment from the exon 6-8 of 21-hydroxylase active gene-CYP21 (primers 5'GAGGGATCACATCGTCGTGGAGATG3' and 5'TTCGTGGTCTAGCTCCTCCTG3'). The PCR protocol was: 94 degrees C-2 min followed by 32 cycles of 94 degrees C-1 min; 63 degrees C-1 min; 72 degrees C-2 min and a extension cycle of 72 degrees C-10 min. The karyotype was performed in chorionic villus biopsies cultures confirm PCR results. In one case the material was not sufficient for karyotyping. This protocol was tested in 200 DNA blood samples from males and females and provided CYP21B amplification in all of them as well as the expected SRY amplification in the males. CYP21B was amplified in all samples. SRY gene in 8 samples of chorionic villus biopsies was positive in 3 male and negative in 5 female fetuses. The fetal sex was confirmed by karyotype or after birth. We conclude that this protocol provides an easy, fast and safe fetal sex determination method.
Assuntos
Amostra da Vilosidade Coriônica , DNA/análise , Amplificação de Genes , Reação em Cadeia da Polimerase , Diagnóstico Pré-Natal , Análise para Determinação do Sexo/métodos , DNA/genética , Feminino , Humanos , Cariotipagem , Masculino , Fatores de Tempo , Cromossomo Y/genéticaRESUMO
Mutations in the sex-determining region of the Y chromosome (the SRY gene) have been reported in low frequency in patients with 46,XY gonadal dysgenesis. We investigated 21 Brazilian 46,XY sex-reversed patients, who presented either complete or partial gonadal dysgenesis or embryonic testicular regression syndrome. Using Southern blotting, polymerase chain reaction, denaturing gradient gel electrophoresis and direct sequencing, we analyzed deletions and point mutations in the SRY gene. We found a missense mutation at codon 18 upstream of the 5' border of the HMG box of the SRY gene in one patient with partial gonadal dysgenesis. This variant sequence was also found in DNA obtained from blood and sperm cells of his father and in blood cells of his normal brother. The S18N mutation was not found in 50 normal males, ruling out the possibility of a common polymorphism. We identified a novel familial missense mutation (S18N) in the 5' non-HMG box of the SRY gene in 1 of 21 patients with 46,XY sex reversal.