RESUMO

For phytosanitary purposes, the prevalence and incidence of viruses found in strawberry production within a centralized breeding program was investigated in Abasolo and Irapuato Counties, Guanajuato State, Mexico. Single and mixed infections of Strawberry mottle virus (SMoV) and Strawberry crinkle virus (SCV) were originally reported in the area (3), and subsequently, Strawberry latent ringspot virus (SLRSV) was also found (4). Samples of strawberry plants showing viral symptoms: stunting, mild chlorosis and reddening, occasional wrinkled, curled, and deformed leaves that may exhibit mottling, and chlorotic spots, forming a putative virus complex were collected in April and December 2007 and July and December 2008. The detection and identification of viruses reported in the United States, the country of origin of most of the imported plantlets, was carried out with sets of primers for 11 viruses, through reverse transcription (RT)-PCR (developed by Robert Martin and Ioannis Tzanetakis in Corvallis, OR). The endogenous NADH 2 subunit was employed to test the quality of the RNA extracted. Amplification conditions were: 40 cycles of 1 min at each temperature, denaturation at 95°C, annealing at 50°C for Strawberry necrotic shock virus (SNSV); 52°C for Strawberry mild yellow edge virus (SMYEV); 55°C for Fragaria chiloensis latent virus (FClLV), Strawberry pallidosis associated virus (SPaV), Fragaria chiloensis cryptic virus (FClCV), and SMoV; and 58°C for SCV and NADH dehydrogenase, followed by a final extension at 72°C of 5 min after completion of the 40 cycles. The cloning and nucleotide sequencing of amplified fragments revealed the presence of seven viral species in 40 samples collected. These were FClLV, SCV, SMoV, SNSV, SPaV, and SMYEV, which were allocated GenBank accession numbers of JQ629412, JQ629413, JQ629414, JQ629415, JQ629416, and JQ629417, respectively. Strawberry UC-4 and UC-10 (1,2) were planted as indicators of viral infections on an experimental plot. All seven viruses were detected in single or mixed infections. SMoV was the most commonly found in combination with other viruses. Out of 40 samples, 35 were positive for the presence of viruses and six had single infections, of which five had SMoV and one had SPaV. The remaining 29 samples had mixed infections with two or more viruses in a total of 22 combinations. The combination of FCICV + SMoV was present in five samples, whereas the combination of SMoV + SMYEV was in two samples. All other samples had two and up to six different viruses per plant. SMoV was detected in 26 out of the 40 samples tested. SNSV and FClCV were detected in 14 samples. SMYEV was present in 13 samples. SCV was present in nine samples, whereas SPaV and FClLV were found in eight samples each. To the best of our knowledge, this is the first report of FClLV, FClCV, SNSV, SMYEV, and SPaV in Mexico. References: (1) N. W. Frazier. Plant Dis. Rep. 58:28, 1974. (2) N. W. Frazier. Plant Dis. Rep. 58:203, 1974. (3) D. Teliz-Ortiz and A. Trejo-Reyes. Rev. Mex. Fitopatol. 7:38, 1989. (4) L. Pérez-Moreno et al. Rev. Mex. Fitopatol. 22:187, 2004.

RESUMO

Pepper is an economically important crop in many countries around the world but it is susceptible to many diseases. In Mexico, diseases caused by bipartite begomoviruses have emerged as important problems in pepper. Several control strategies have been explored wiht little success; most of them are based on the avoidance of virus transmission and the breeding for resistance. Abiotic inducers can act at various points in the signaling pathways involved in disease resistance, providing long-lasting, wide-spectrum resistance. Benzothiadiazole (BTH) shares the property of activating the systemic acquired resistance pathway downstream from the SA signaling. In this work, resistance to PepGMV infection was induced in pepper plants by activating the SA pathway using BTH treatment. The resistance was characterized by evaluating symptom appearance, virus accumulation and viral movement. Our results showed that BTH could be an attractive alternative to induce geminivirus resistance in pepper plants without a significant damage of the fruit quality and productivity.

Assuntos

RESUMO

Pepper is an economically important crop in many countries around the world but it is susceptible to many diseases. In Mexico, diseases caused by bipartite begomoviruses have emerged as important problems in pepper. Several control strategies have been explored wiht little success; most of them are based on the avoidance of virus transmission and the breeding for resistance. Abiotic inducers can act at various points in the signaling pathways involved in disease resistance, providing long-lasting, wide-spectrum resistance. Benzothiadiazole (BTH) shares the property of activating the systemic acquired resistance pathway downstream from the SA signaling. In this work, resistance to PepGMV infection was induced in pepper plants by activating the SA pathway using BTH treatment. The resistance was characterized by evaluating symptom appearance, virus accumulation and viral movement. Our results showed that BTH could be an attractive alternative to induce geminivirus resistance in pepper plants without a significant damage of the fruit quality and productivity.

Assuntos

RESUMO

Rhynchosia minima (L.) DC. (Fabaceae) plants exhibiting bright golden mosaic symptoms were previously associated with begomovirus infection in Yucatan, México [1]. To characterize the begomovirus infecting these plants, the complete bipartite genome was cloned and sequenced. Sequence comparisons indicated that the virus was distinct from all other begomoviruses known to date, including those previously identified from symptomatic R. minima, and the name Rhynchosia yellow mosaic Yucatan virus (RhYMYuV) is proposed. Pairwise comparisons indicated that RhYMYuV DNA-A [2,597 nt, (EU021216)] and DNA-B [2,542 nt, (FJ792608)] components shared the highest nt sequence identity with Cabbage leaf curl virus (CaLCuV), 87% for component A and 71% for component B. Phylogenetic analysis indicated that both components of RhYMYuV are most closely related to other New World begomoviruses, having as closest relatives immediate outliers to the major Squash leaf curl virus (SLCV) clade. Recombination analysis of the RhYMYuV genome indicated that the DNA-A component has arisen through intermolecular recombination. R. minima plants inoculated with the monomeric clones developed a bright yellow mosaic similar to symptoms observed in naturally infected plants, confirming that the clones were infectious. Nicotiana benthamiana plants biolistically inoculated with monomeric clones developed curling and chlorosis in the newly emerging leaves. RhYMYuV was also detected in symptomatic Desmodium sect. Scorpiurus Benth. (Fabaceae) that were collected near the RhYMYuV-infected plants.

Assuntos

RESUMO

A possible consequence of planting genetically modified organisms (GMOs) in centres of crop origin is unintended gene flow into traditional landraces. In 2001, a study reported the presence of the transgenic 35S promoter in maize landraces sampled in 2000 from the Sierra Juarez of Oaxaca, Mexico. Analysis of a large sample taken from the same region in 2003 and 2004 could not confirm the existence of transgenes, thereby casting doubt on the earlier results. These two studies were based on different sampling and analytical procedures and are thus hard to compare. Here, we present new molecular data for this region that confirm the presence of transgenes in three of 23 localities sampled in 2001. Transgene sequences were not detected in samples taken in 2002 from nine localities, while directed samples taken in 2004 from two of the positive 2001 localities were again found to contain transgenic sequences. These findings suggest the persistence or re-introduction of transgenes up until 2004 in this area. We address variability in recombinant sequence detection by analyzing the consistency of current molecular assays. We also present theoretical results on the limitations of estimating the probability of transgene detection in samples taken from landraces. The inclusion of a limited number of female gametes and, more importantly, aggregated transgene distributions may significantly lower detection probabilities. Our analytical and sampling considerations help explain discrepancies among different detection efforts, including the one presented here, and provide considerations for the establishment of monitoring protocols to detect the presence of transgenes among structured populations of landraces.

Assuntos

RESUMO

Whitefly-transmitted viruses have caused severe losses in tomato crops (Solanum lycopersicum) in Cuba. In 2006 and 2007, tomato greenhouses across eastern Cuba exhibited high levels of Bemisia tabaci (B biotype) infestation. Some plants showed interveinal chlorosis and a severe yellow mosaic, combined with leaf brittleness. These symptoms were different from those induced by Tomato yellow leaf curl virus (TYLCV-IL(CU)). Only 12 of 31 symptomatic samples resulted in positive PCR assays with TYLCV-specific primers (CTGAATGTTTGGATGGAAATGTGC and GCTCGTAAGTTTCCTCAACGGAC). A reverse transcription (RT)-PCR analysis for Tomato chlorosis virus (ToCV) with generic (HS-11/HS-12) and specific primers (ToC-5/ToC-6) was also carried out (2). Sequence analysis of the cloned RT-PCR products (463 bp) confirmed the presence of ToCV in Cuba. The fragment had 97 to 98% identity with GenBank isolates from Spain (DQ136146), Florida (AY903448), and Reunion Island, France (AJ968396). Cloned TYLCV and ToCV amplicons were used as probes to reanalyze the selected 31 samples by a dot-blot hybridization assay in search of mixed infections (1). The assay showed 16 samples to be positive for ToCV, 4 for TYLCV, 8 for both, and 3 samples were negative. To our knowledge, this is the first report of ToCV and TYLCV/ToCV mixed infections in Cuba. References: (1) Y. Abou-Jawdha et al. Plant Dis. 90:378, 2006. (2) C. I. Dovas et al. Plant Dis. 86:1345, 2002.

RESUMO

Since 2001, geminivirus-like disease symptoms have been observed in tomato plants on the Baja California Peninsula of Mexico. These diseases have been associated with large populations of Bemisia tabaci (Genn.) in commercial fields and have caused dramatic decreases in expected yields. Leaf samples from tomato plants displaying symptoms of stunting and severe upward leaf curling were collected in March 2002 in fields located near the city of La Paz, Baja California Sur (BCS). Total DNA was extracted and tested for the presence of geminiviral DNA using polymerase chain reaction (PCR) with begomovirus-specific degenerate primer pairs PALIv1978/PARIc494 and PALIc1978/PARIv494 (4). PCR products of the expected size (~1.16 and ~1.45 kb) were obtained, cloned into pGEM-T Easy (Promega, Madison, WI), and sequenced. Restriction fragment length polymorphism analysis of the PCR fragments was performed using EcoRI, HindIII, PstI, and XbaI. Restriction fragment patterns were the same for all amplicons and no evidence of mixed infection was obtained. In addition, experimental transmission by whiteflies and inoculations by biolistics consistently induced severe leaf epinasty and stunted growth on tomato seedlings. The complete (2,606 nt) DNA-A sequence of the infecting virus was determined (GenBank Accession No. AY339618) and compared with viral sequences available at GenBank-EMBL databases using BLASTN and the CLUSTAL program (MegAlign, DNASTAR, Madison, WI). The highest nucleotide identity was obtained with the recently described Tomato chino Baja California virus, ToChBCV (90.2%, GenBank Accession No. AY339619), isolated from tomato plantings in El Carrizal, BCS, 100 km from La Paz (3). The second and third best scores were obtained with Tomato severe leaf curl virus from Nicaragua (ToSLCV-NI, 79.6%, GenBank Accession No. AJ508784) and Guatemala (ToSLCV-GT94, 73.8%, GenBank Accession No. AF130415), respectively. Overall, sequence similarity with other New World begomoviruses was rather low (less than 70% identity). Careful analysis of differences between the La Paz isolate and its closest relative, ToChBCV from El Carrizal, revealed that they display different Ori-associated iterons (i.e., replication (Rep)-binding sites) having GGAGTA and GGGTCY core sequences, respectively (1). Moreover, sequence comparisons of the Rep-binding domain (aa 1-120) showed that these domains are only 71% identical. Current taxonomic criteria for begomoviruses establishes that a virus DNA-A sequence identity below 89% with its closest relative is indicative of a separate species (2). Since the La Paz and El Carrizal isolates share 90.2% nt identity, they should be considered strains of a same virus species, recently renamed Tomato chino La Paz virus, ToChLPV (2). Nevertheless, the remarkable differences in their putative replication specificity determinants suggest that ToChLPV and ToChLPV-[BCS] could be incompatible in replication, an interesting issue that should be experimentally addressed. References: (1) G. R. Arguello-Astorga et al. Virology 203:90, 1994. (2) C. Fauquet and J. Stanley. Arch. Virol. 150:2151, 2005. (3) R. J. Holguín-Peña et al. Plant Dis. 89:341, 2005. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

RESUMO

More than 10,000 ha of tomatoes are grown in the field and greenhouses on the Baja California Peninsula of Mexico. Information about the etiology of geminivirus-like diseases affecting tomato crops in all horticultural regions in the area has been difficult to obtain and assess. From 2001 through 2003, stunting, foliar discoloration, reduced leaf size, and leaf crumpling symptoms were observed and analyzed in one large area of tomato plantings in El Carrizal (near the city of La Paz in Baja California Sur). This leaf curl disease resembled that caused by Chino del tomate virus and has been observed at levels of incidence ranging from 60 to 90%. DNA isolated from symptomatic plants was analyzed using DNA hybridizaton and polymerase chain reaction (PCR) amplification of the 5' regions of the replication and coat protein genes, including the intergenic region (3). Comparisons of the nucleotide sequence (GenBank Accession No. AY339619) with corresponding sequences in GenBank resulted in 84.2% identity with Tomato mild mottle virus and 61.7% with Tomato severe leaf curl virus; both isolates originate from Central America. The relatively low nucleotide sequence identities from its closest relatives suggested that the virus may be a new begomovirus species of unambiguous American ancestry. In a phylogenetic analysis using PAUP 4.0 software, the Baja California isolate clustered in a separate group from other Mexican sequences. Moreover, the iteron (iterative sequences motifs associated in virus replication) arrangements (1) are unique among known New World begomoviruses, but identical to analogous elements from a tobacco-infecting begomovirus from China. On the other hand, it is well known that there are interactions between geminiviruses in mixed infections in some horticultural areas of Mexico (2). To determine the identity of the putative geminivirus involved in the disease, we used selected restriction enzyme (EcoRI, HindIII and XbaI) analysis and PCR with specific primers. No evidence of mixed infections with other geminiviruses was obtained. DNA fragments of the expected size (1.1 kb) showed different digestion patterns compared with other well-characterized geminiviruses isolated from Mexico such as Chino del tomate virus, Pepper huasteco yellow vein virus, Tomato leaf curl Sinaloa virus, and Pepper golden mosaic virus. Epidemiological, experimental, and natural host range studies indicated that the Baja California isolate has a relatively narrow host range infecting tomatoes, peppers (Capsicum annuum L.), and Peruvian apple (Nicandra physalodes L.). Reproduction of characteristic leaf curling symptoms in tomato seedlings infected with viruliferous whiteflies (Bemisia tabaci Genn.) and inoculated biolistically using infectious DNA (0.5 µg/ml) as inoculum were obtained. Koch's postulates were completed using PCR and DNA hybridization to confirm virus identity. These results confirm that the Baja California isolate is different from other begomoviruses isolated from Mexico. The virus is tentatively named Tomato chino Baja California virus (ToChBCV), genus Begomovirus, family Geminiviridae. References: (1) G. R. Arguello-Astorga et al. Arch. Virol. 146:1465, 2001. (2) J. Mendez-Lozano et al. Phytopathology 93:270, 2003. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993.

RESUMO

A 597 nt fragment from Tomato mottle Taino virus (ToMoTV) DNA-A, with 459 nt located upstream of the Replication-associated protein translation start codon, was tested for promoter activity in solanaceous plants. The promoter activity of this fragment (pRep(459::Rep)) was demonstrated when it was introduced upstream the uidA reporter gene into tobacco, potato and tomato plants by genetic transformation. It became active in 7-day-old transgenic tobacco seedlings as revealed by a vascular-specific pattern of gene expression which was maintained during the continued growth of the plant. Transformed potato and tomato plants also showed a vascular-specific pattern of expression. In comparative assays, pRep(459::Rep) showed an expression activity 10-40-fold less than the 35S promoter from Cauliflower mosaic virus. To delimit the minimal cis-acting elements necessary for vascular specificity of this promoter, a set of PCR deletion mutants of pRep(459::Rep) (pRep(459), pRep(324), pRep(203), pRep(145), pRep(132) and pRep(115)), were generated and used to transform tobacco plants. Transgenic tobacco plants belonging to all the pRep versions were blue stained in the vascular system except those from the pRep(115) version. The results described in this report demonstrate that the minimal sequences necessary for the pRep promoter activity are confined in a segment of 132 nts (located between the nts 2454 and 2585 of the ToMoTV DNA A) and that this promoter harbors those elements sufficient for vascular-specific expression.

Assuntos

RESUMO

In the state of Baja California Sur, tomatoes (Lycopersicon esculentum Mill.) are cultivated on approximately 1,000 ha. Occurrence of viral diseases is currently causing low yields and severe losses. Virus-like symptoms (severe leaf curling, stunting, reduced leaf size, and mosaic patterns) were observed on 99% of tomato plants in 2002 in La Paz, Baja California Sur. Whiteflies (Bemisia tabaci Gennadius) were present in affected fields and appeared to be associated with the disease. The virus was experimentally transmitted from infected plants to tomato and peppers seedlings by whiteflies and as infectious DNA (replicative form) by mechanical and biolistic inoculation. Symptoms similar to those found in the field were observed in experimental transmission assays. DNA from inoculated plants was extracted and analyzed by DNA hybridization and polymerase chain reaction (PCR) using degenerate (1) and specific (2) primers. The PCR products (1.1 kb) obtained from the common region (GenBank Accession No. AY368336) suggested the presence of a bipartite geminivirus. The nucleotide sequence of the PCR products showed a 98% identity to Pepper golden mosaic virus-Tamaulipas strain (PepGMV-Tam) in the intergenic region (IR). Similar identities (97%) were obtained by using the predicted amino acid sequences of the amino termini of the coat proteins. Identities in the replication proteins (92%) and IR iterative sequence analyses show that the PepGMV-La Paz isolate is a closely related strain of PepGMV-Tam. To our knowledge, this is the first report of PepGMV affecting tomato crops in Baja California Sur, Mexico. References: (1) M. R. Rojas et al. Plant Dis. 77:340. 1993. (2) I. Torres-Pacheco et al. Phytopathology 86:1186, 1996.