RESUMO

Resumen: La tendinopatía cálcica es causada por el depósito patológico de cristales de hidroxiapatita de calcio en los tendones y es una causa común de dolor en las articulaciones. Afecta más frecuentemente al hombro y la cadera, con hallazgos característicos en imágenes; sin embargo, cualquier tendón puede estar involucrado. Ocasionalmente, la tendinopatía cálcica puede simular patología agresiva, como infección o neoplasia, especialmente en RM. Fisiotpatológicamente, las calcificaciones provendrían de una diferenciación anormal de las células madre del tendón, que comienzan a producir calcio, aunque todavía no es del todo claro. Los radiólogos deben estar familiarizados con los hallazgos de las imágenes para distinguir la tendinopatía cálcica de procesos más agresivos. La aspiración y lavado guiado bajo ecografía es una técnica útil realizada por el radiólogo para el tratamiento de casos sintomáticos. La familiaridad con estos procedimientos y su apariencia en imágenes es un aspecto importante en el manejo de esta enfermedad. El propósito de esta revisión es analizar la etiopatogenia de la tendinopatía cálcica, la evaluación con imágenes en los sitios de presentación más comunes y también en los menos frecuentes, así como el papel que desempeña la ecografía en el tratamiento de la patología.

Abstract: Calcific tendinitis is caused by abnormal deposition of calcium hydroxyapatite crystals in tendons and is a common cause of joint pain. The disease typically affects the shoulder and hip, with characteristic imaging findings; however, any tendon can be involved. Occasionally, calcific tendinitis can mimic aggressive disorders, such as infection and neoplasm, especially on MRI. Apparently, the calcifications come from an abnormal differentiation of the tendon stem cells, which begin to produce calcium. Radiologists should be familiar with the imaging findings to distinguish calcific tendinitis from more aggressive processes. Image-guided percutaneous needle aspiration is a useful technique performed by the radiologist for the treatment of symptomatic cases. Being familiar with these processes and their imaging appearance is an important aspect in the management of this common disease. The purpose of this review is to analyze the pathogenesis of calcium tendinopathy, the evaluation of images in both the most common and less frequent presentation sites, as well as the role played by ultrasound in the treatment of pathology.

Assuntos

RESUMO

In this work, we present a thorough study of the thermoelectric properties of silicene nanoribbons in the presence of a random distribution of atomic vacancies. By using a linear approach within the Landauer formalism, we calculate phonon and electron thermal conductances, the electric conductance, the Seebeck coefficient and the figure of merit of the nanoribbons. We found a sizable reduction of the phonon thermal conductance as a function of the vacancy concentration over a wide range of temperature. At the same time, the electric properties are not severely deteriorated, leading to an overall remarkable thermoelectric efficiency. We conclude that the incorporation of vacancies paves the way for designing better and more efficient nanoscale thermoelectric devices.

RESUMO

We isolated and compared three tomato spotted wilt virus (TSWV) isolates from lettuce (TSWV-Let), pepper (TSWV-Pep), and tomato (TSWV-Tom) from central Mexico to determine their ability to infect a set of eighteen differential plant species from seven families. TWSV-Let was an aggressive isolate with the ability to infect up to 52% of the differential plants, including maize, under greenhouse conditions. The nucleotide (nt) sequences of the three isolates are more than 90% similar in the M and S RNA segments. In the M segment of the TSWV-Let isolate, we detected nt changes in their intergenic region (IGR) and, in the Gc gene, a region containing a recombination site, as well as a synapomorphy associated with one of three sites under positive selection with a change in one aa residue (a cysteine-to-valine mutation). We speculate on the association of these features in the Gc gene with host selection, adaptation, aggressiveness, and ability to infect maize plants.

Assuntos

RESUMO

We explore proximity-induced ferromagnetism on transition metal dichalcogenides (TMDs), focusing on molybdenum ditelluride ribbons with zigzag edges, deposited on ferromagnetic europium oxide (EuO). A tight-binding model incorporates exchange and Rashba fields induced by proximity to EuO or similar substrates. For in-gap Fermi levels, electronic modes in the nanoribbon are localized along the edges, acting as one-dimensional (1D) conducting channels with tunable spin-polarized currents. TMDs on magnetic substrates can become very useful in spintronics, providing versatile platforms to study the proximity effects and electronic interactions in complex 1D systems.

RESUMO

In recent years, the enhancement of thermoelectric efficiencies has been accomplished in nanoscale systems by making use of quantum effects. We exploit the presence of quantum interference phenomena such as bound states in the continuum and Fano antiresonances in trilayer silicene flakes to produce sharp changes in the electronic transmission of the system. By applying symmetric gate voltages the thermoelectric properties can be tuned and, for particular flake lengths, a great enhancement of the figure of merit can be achieved. We show that the most favorable configurations are those in which the electronic transmission is dominated by the coupling of bound states to the continuum, tuned by an external gate.

RESUMO

En el año 2013, la Organización Panamericana de la Salud (OPS), Oficina Regional de la Organización Mundial de la Salud (OMS) en las Américas, orientó su enfoque relacionado con los Recursos Humanos para la Salud en un esfuerzo para lograr el Acceso Universal a la Salud y la Cobertura Universal de Salud, que en conjunto se identifican como Salud universal. Los Estados miembros de la OPS/OMS aprobaron la Resolución CD52.R13 « Recursos Humanos para la Salud: Aumentar el Acceso al Personal Sanitario Capacitado en Sistemas de Salud Basados en la Atención Primaria de Salud ¼ con el objeto de fortalecer los sistemas de salud de estos países. En esta resolución se insta a que "los Estados Miembros faculten y brinden apoyo a los equipos colaborativos multiprofesionales de atención primaria de salud sobre la base de modelos establecidos de atención, mejoren el alcance de la práctica de cada profesión hasta su máximo potencial según sus competencias". También, se insta que "estimulen reformas en la educación de las profesiones de atención de salud para apoyar los sistemas de salud basados en la atención primaria de salud y aumentar el número de plazas en las profesiones de atención de salud pertinentes para la atención primaria de salud, incluidos los médicos de familia, las enfermeras de práctica avanzada y los especialistas clínicos que no son médicos, de acuerdo con las prioridades y las políticas públicas en la atención primaria de salud".

Assuntos

RESUMO

El objetivo de este artículo es dar a conocer los resultados de un estudio analítico1 acerca del manejo del paciente con disfagia por parte de técnicos paramédicos en el Hospital San Juan de Dios de Santiago, Chile, y del desarrollo de competencias tras la aplicación de un programa de capacitación. En primera instancia, se aplicó una encuesta validada por tres fonoaudiólogas para determinar el nivel de conocimiento e idoneidad de 145 funcionarios de la Unidad de Paciente Crítico, Cirugía y Medicina, la que evidenció que un 61 por ciento de los encuestados poseía un manejo “no deseable” del paciente y un 39 por ciento de ellos un manejo “regular”. Posteriormente se les impartió un programa de capacitación teórico-práctico con una duración de 21 horas pedagógicas dictadas por el equipo interdisciplinario (médico, enfermero, fonoaudiólogo, kinesiólogo, terapeuta ocupacional y nutricionista) durante tres jornadas. Al término de estas, se les aplicó nuevamente la encuesta, con el fin de comparar los datos con la información inicial. Tras la intervención, el 57 por ciento logró un nivel “deseable”, 41 por ciento un nivel “regular” y solo un 2 por ciento un nivel “no deseable”. Como conclusión, la formación técnica de los paramédicos no les brinda las herramientas suficientes para el manejo de los pacientes con disfagia, por lo que es labor de la institución de salud capacitarlos continuamente para evitar riesgos en los usuarios.

The aim of this article is to present the results of an analytical study in the management of patients with dysphagia by paramedics at San Juan de Dios Hospital in Santiago, Chile, and the development of skills after the implementation of a training program. First of all, a survey validated by three speech therapists was applied to determine the level of knowledge and suitability of 145 paramedics of the Critical Patient Unit, Surgery and Medicine. This survey found that 61 percent had a “non-desirable” management in patients, and 39 percent a “middle” level. Secondly, they participated in a 3-days theoretical and practical program, which lasted 21 hours. The classes were taught by an interdisciplinary team that attend the pathology (Doctor, Nurse, Speech Therapist, Physiotherapist, Occupational Therapist and Nutritionist), where at the end they were re-applied the survey to determine the new data by statistical analysis. After the intervention, 57 percent achieved a “desirable” level, 41 percent a “middle” level, while only 2 percent a “non-desirable” level. In conclusion, the technical training of paramedics does not provide them with the necessary tools for the management of patients with dysphagia; therefore, it is the health institution’s work to train them in order to avoid risks in patients.

Assuntos

RESUMO

Over 5% of the world's population has varying degrees of hearing loss. Mutations in GJB2 are the most common cause of autosomal recessive non-syndromic hearing loss (ARNHL) in many populations. The frequency and type of mutations are influenced by ethnicity. Guatemala is a multi-ethnic country with four major populations: Maya, Ladino, Xinca, and Garifuna. To determine the mutation profile of GJB2 in a ARNHL population from Guatemala, we sequenced both exons of GJB2 in 133 unrelated families. A total of six pathogenic variants were detected. The most frequent pathogenic variant is c.131G>A (p.Trp44*) detected in 21 of 266 alleles. We show that c.131G>A is associated with a conserved haplotype in Guatemala suggesting a single founder. The majority of Mayan population lives in the west region of the country from where all c.131G>A carriers originated. Further analysis of genome-wide variation of individuals carrying the c.131G>A mutation compared with those of Native American, European, and African populations shows a close match with the Mayan population.

RESUMO

Mexico contributes 20% of the total worldwide pepper exports (1). Impatiens necrotic spot virus (INSV) (genus Tospovirus; family Bunyaviridae) has emerged and has possibly caused diseases in various crops and ornamentals in Mexico. INSV was treated as a quarantine virus in Mexico (2) but not anymore. During the growing seasons of 2009 to 2011, surveys were conducted in the counties of Guanajuato and Querétaro in the states of the same names. Sampling included tomatillo (Physalis ixocarpa) and pepper (Capsicum spp.) plantations where plants with possible viral symptoms were observed. The symptoms observed were dark necrotic spots on some leaves and on the stems. These were similar to those observed elsewhere (3). Leaf spots further developed into localized necrotic areas. Using ELISA (Agdia, Elkhart, IN) with polyclonal antibodies, all collected samples showing symptoms tested positive for INSV and negative for Alfalfa mosaic virus (AMV), Cucumber mosaic virus (CMV), Potato X virus (PVX), Potato Y virus (PVY), Tobacco mosaic virus (TMV), Tomato spotted wilt virus (TSWV), Tobacco ringspot virus (TRSV), and Tomato ringspot virus (ToRSV). In order to identify the causal agent of these symptoms, INSV-specific sequences available for the S genomic fragments were obtained from NCBI GenBank. They were aligned and used to design primers to amplify a 250-bp fragment from total extracted RNA from healthy and symptomatic plants using reverse transcription (RT)-PCR. Primers used were INSVF (5'CCCAACTGCCTCTTTAGTGC3') and INSVR (5'GGACAATGGATCTGCTCTGA3'). Three extracted plasmids, each containing an amplified and cloned fragment for the pepper and tomatillo isolates, were sequenced (GenBank Accession Nos. KC503051 and KC503052, respectively). Both nucleotide sequences showed 95% identity with the Chinese, Italian, and Japanese INSV sequences (FN400773, DQ425096, and AB207803, respectively) and 94% identity to other INSV isolates (4). The putative Mexican INSV pepper isolate, derived from a necrotic spot, was mechanically inoculated to other experimental host plants after grinding 1 g of symptomatic leaf tissue in 3 ml of a buffer with quaternary ammonium salts at 0.5%, pH 7.8. Ten plants, at the second true-leaf stage, of each Capsicum annuum cv. cannon and Citrullus lanatus were inoculated after carborundum abrasion of the second true leaf. At 15 days post inoculation, systemic chlorotic necrotic spots, stunting, and apical malformation were observed in capsicum plants while wilting was shown in watermelon plants. RT-PCR analyses and nucleotide sequence of the amplified product confirmed the presence and identity of both virus isolates. To our knowledge, this is the first report of INSV in Mexico found naturally in tomatillo and pepper and experimentally in watermelon plants. Derived from this report, INSV distribution in Mexico should be studied due to its potential impact on these two economically important crops. References: (1) Food and Agriculture Organization of the United Nations. FAOSTAT, retrieved online at http://faostat.fao.org , 2013. (2) DGSV-CNRF. Impatiens necrotic spot virus (INSV). SAGARPA-SENASICA. México, 2011. (3) M. Ding et al. Plant Dis. 95:357, 2011. (4) I. Mavric et al. Plant Dis. 85:12, 2001.

RESUMO

For phytosanitary purposes, the prevalence and incidence of viruses found in strawberry production within a centralized breeding program was investigated in Abasolo and Irapuato Counties, Guanajuato State, Mexico. Single and mixed infections of Strawberry mottle virus (SMoV) and Strawberry crinkle virus (SCV) were originally reported in the area (3), and subsequently, Strawberry latent ringspot virus (SLRSV) was also found (4). Samples of strawberry plants showing viral symptoms: stunting, mild chlorosis and reddening, occasional wrinkled, curled, and deformed leaves that may exhibit mottling, and chlorotic spots, forming a putative virus complex were collected in April and December 2007 and July and December 2008. The detection and identification of viruses reported in the United States, the country of origin of most of the imported plantlets, was carried out with sets of primers for 11 viruses, through reverse transcription (RT)-PCR (developed by Robert Martin and Ioannis Tzanetakis in Corvallis, OR). The endogenous NADH 2 subunit was employed to test the quality of the RNA extracted. Amplification conditions were: 40 cycles of 1 min at each temperature, denaturation at 95°C, annealing at 50°C for Strawberry necrotic shock virus (SNSV); 52°C for Strawberry mild yellow edge virus (SMYEV); 55°C for Fragaria chiloensis latent virus (FClLV), Strawberry pallidosis associated virus (SPaV), Fragaria chiloensis cryptic virus (FClCV), and SMoV; and 58°C for SCV and NADH dehydrogenase, followed by a final extension at 72°C of 5 min after completion of the 40 cycles. The cloning and nucleotide sequencing of amplified fragments revealed the presence of seven viral species in 40 samples collected. These were FClLV, SCV, SMoV, SNSV, SPaV, and SMYEV, which were allocated GenBank accession numbers of JQ629412, JQ629413, JQ629414, JQ629415, JQ629416, and JQ629417, respectively. Strawberry UC-4 and UC-10 (1,2) were planted as indicators of viral infections on an experimental plot. All seven viruses were detected in single or mixed infections. SMoV was the most commonly found in combination with other viruses. Out of 40 samples, 35 were positive for the presence of viruses and six had single infections, of which five had SMoV and one had SPaV. The remaining 29 samples had mixed infections with two or more viruses in a total of 22 combinations. The combination of FCICV + SMoV was present in five samples, whereas the combination of SMoV + SMYEV was in two samples. All other samples had two and up to six different viruses per plant. SMoV was detected in 26 out of the 40 samples tested. SNSV and FClCV were detected in 14 samples. SMYEV was present in 13 samples. SCV was present in nine samples, whereas SPaV and FClLV were found in eight samples each. To the best of our knowledge, this is the first report of FClLV, FClCV, SNSV, SMYEV, and SPaV in Mexico. References: (1) N. W. Frazier. Plant Dis. Rep. 58:28, 1974. (2) N. W. Frazier. Plant Dis. Rep. 58:203, 1974. (3) D. Teliz-Ortiz and A. Trejo-Reyes. Rev. Mex. Fitopatol. 7:38, 1989. (4) L. Pérez-Moreno et al. Rev. Mex. Fitopatol. 22:187, 2004.